Transcript: Human XM_017025715.1

PREDICTED: Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5 (ST8SIA5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST8SIA5 (29906)
Length:
2097
CDS:
380..1288

Additional Resources:

NCBI RefSeq record:
XM_017025715.1
NBCI Gene record:
ST8SIA5 (29906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035299 GCACGAAATATTGGAAGTGAA pLKO.1 349 5UTR 100% 4.950 6.930 N ST8SIA5 n/a
2 TRCN0000431529 TATATCGAAGACTTAGCTATG pLKO_005 1766 3UTR 100% 6.000 4.200 N ST8SIA5 n/a
3 TRCN0000419976 GGGACAAAGCTCAAGTATGAG pLKO_005 536 CDS 100% 4.950 3.465 N ST8SIA5 n/a
4 TRCN0000035300 CCTCTACATCACTCACCACTA pLKO.1 1147 CDS 100% 4.050 2.835 N ST8SIA5 n/a
5 TRCN0000035303 CAGCATCATCACAGAGAGGTT pLKO.1 802 CDS 100% 2.640 1.848 N ST8SIA5 n/a
6 TRCN0000035302 CCAGTTTAAGAAGTGTGCTGT pLKO.1 634 CDS 100% 2.640 1.848 N ST8SIA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025715.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03100 pDONR223 100% 80.3% 80.3% None 0_1ins222 n/a
2 ccsbBroad304_03100 pLX_304 0% 80.3% 80.3% V5 0_1ins222 n/a
3 TRCN0000474698 TTGTATGGGTTAGAATCATCGGTC pLX_317 46.3% 80.3% 80.3% V5 0_1ins222 n/a
Download CSV