Transcript: Human XM_017025748.2

PREDICTED: Homo sapiens SMAD family member 2 (SMAD2), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMAD2 (4087)
Length:
10384
CDS:
416..1660

Additional Resources:

NCBI RefSeq record:
XM_017025748.2
NBCI Gene record:
SMAD2 (4087)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040037 CCTAAGTGATAGTGCAATCTT pLKO.1 1303 CDS 100% 5.625 7.875 N SMAD2 n/a
2 TRCN0000288652 CCTAAGTGATAGTGCAATCTT pLKO_005 1303 CDS 100% 5.625 7.875 N SMAD2 n/a
3 TRCN0000040036 CGATTAGATGAGCTTGAGAAA pLKO.1 366 5UTR 100% 4.950 6.930 N SMAD2 n/a
4 TRCN0000288651 CGATTAGATGAGCTTGAGAAA pLKO_005 366 5UTR 100% 4.950 6.930 N SMAD2 n/a
5 TRCN0000040035 GCGTTGCTCAAGCATGTCATA pLKO.1 1639 CDS 100% 4.950 6.930 N SMAD2 n/a
6 TRCN0000288592 GCGTTGCTCAAGCATGTCATA pLKO_005 1639 CDS 100% 4.950 6.930 N SMAD2 n/a
7 TRCN0000089337 CTAAGTGATAGTGCAATCTTT pLKO.1 1304 CDS 100% 5.625 4.500 N Smad2 n/a
8 TRCN0000327372 CTAAGTGATAGTGCAATCTTT pLKO_005 1304 CDS 100% 5.625 4.500 N Smad2 n/a
9 TRCN0000010477 CAAGTACTCCTTGCTGGATTG pLKO.1 1551 CDS 100% 6.000 4.200 N SMAD2 n/a
10 TRCN0000295815 CAAGTACTCCTTGCTGGATTG pLKO_005 1551 CDS 100% 6.000 4.200 N SMAD2 n/a
11 TRCN0000040033 CCAGTAATAGTTGCATTGATA pLKO.1 2451 3UTR 100% 5.625 3.938 N SMAD2 n/a
12 TRCN0000010478 CATGATCCAGTATCACAGTAT pLKO.1 1979 3UTR 100% 4.950 3.465 N SMAD2 n/a
13 TRCN0000295870 CATGATCCAGTATCACAGTAT pLKO_005 1979 3UTR 100% 4.950 3.465 N SMAD2 n/a
14 TRCN0000010476 GACGATTAGATGAGCTTGAGA pLKO.1 364 5UTR 100% 3.000 2.100 N SMAD2 n/a
15 TRCN0000040034 CCCATCAAATTCAGAGAGGTT pLKO.1 1168 CDS 100% 2.640 1.848 N SMAD2 n/a
16 TRCN0000089025 CCTTACCACTATCAGAGAGTA pLKO.1 746 CDS 100% 4.950 3.465 N Smad3 n/a
17 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6164 3UTR 100% 5.625 2.813 Y KLHL30 n/a
18 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 6032 3UTR 100% 2.640 1.320 Y LINC01098 n/a
19 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6164 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025748.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00961 pDONR223 100% 83.9% 81.3% None (many diffs) n/a
2 ccsbBroad304_00961 pLX_304 0% 83.9% 81.3% V5 (many diffs) n/a
3 TRCN0000465710 TTTCGGTCGAACATAGACGACCGG pLX_317 25.6% 83.9% 81.3% V5 (many diffs) n/a
Download CSV