Transcript: Human XM_017026044.2

PREDICTED: Homo sapiens transmembrane protein 241 (TMEM241), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM241 (85019)
Length:
1963
CDS:
108..1145

Additional Resources:

NCBI RefSeq record:
XM_017026044.2
NBCI Gene record:
TMEM241 (85019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428541 CATTGACCAGCAATACTTAAA pLKO_005 641 CDS 100% 13.200 18.480 N TMEM241 n/a
2 TRCN0000431382 CACAGCTGGCTTATCAATATT pLKO_005 980 CDS 100% 15.000 10.500 N TMEM241 n/a
3 TRCN0000435825 GTGCTGTTTGTGGGTATAATC pLKO_005 336 CDS 100% 13.200 9.240 N TMEM241 n/a
4 TRCN0000005414 AGACGCTCATTGGTGGACTTT pLKO.1 232 CDS 100% 4.950 3.465 N TMEM241 n/a
5 TRCN0000005415 ACTTTGCATAATGTAGCTGAA pLKO.1 405 CDS 100% 4.050 2.835 N TMEM241 n/a
6 TRCN0000005416 CCTGGCTTCTTACCTCACGAA pLKO.1 155 CDS 100% 2.640 1.848 N TMEM241 n/a
7 TRCN0000005417 TGAAGTTATCATCTGTGGGTA pLKO.1 422 CDS 100% 2.640 1.848 N TMEM241 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04470 pDONR223 100% 82.2% 79.7% None (many diffs) n/a
2 ccsbBroad304_04470 pLX_304 0% 82.2% 79.7% V5 (many diffs) n/a
3 TRCN0000475022 CACGAGTAATAAGGAGATGGGGTT pLX_317 55.4% 82.2% 79.7% V5 (many diffs) n/a
Download CSV