Transcript: Human XM_017026054.2

PREDICTED: Homo sapiens nucleolar protein 4 (NOL4), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOL4 (8715)
Length:
3824
CDS:
631..2082

Additional Resources:

NCBI RefSeq record:
XM_017026054.2
NBCI Gene record:
NOL4 (8715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413440 ACCATGACGATTCGGAGAAAG pLKO_005 1334 CDS 100% 10.800 8.640 N NOL4 n/a
2 TRCN0000146905 CCAGATGGAACAGATCATAAA pLKO.1 670 CDS 100% 13.200 9.240 N NOL4 n/a
3 TRCN0000147737 CCATATTCACTGAGGTCTAAA pLKO.1 2095 3UTR 100% 13.200 9.240 N NOL4 n/a
4 TRCN0000147530 GATCCGTAAGTGATGTGTTAA pLKO.1 2220 3UTR 100% 13.200 9.240 N NOL4 n/a
5 TRCN0000423769 TGACTCATGCAGGCGACAATT pLKO_005 1488 CDS 100% 13.200 9.240 N NOL4 n/a
6 TRCN0000130265 CTTTAGTATGTCCAGCCTATT pLKO.1 2282 3UTR 100% 10.800 7.560 N NOL4 n/a
7 TRCN0000129026 GCTCCAATCTTGAAGAAAGAA pLKO.1 881 CDS 100% 5.625 3.938 N NOL4 n/a
8 TRCN0000127176 CCAATCTCTAAGCAGCCCAAA pLKO.1 1447 CDS 100% 4.050 2.835 N Nol4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026054.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11297 pDONR223 100% 72.7% 72.7% None 0_1ins123;772_1077del n/a
2 ccsbBroad304_11297 pLX_304 0% 72.7% 72.7% V5 0_1ins123;772_1077del n/a
3 TRCN0000474534 TAATTCATAGTAGGTCAAAAGAAC pLX_317 41.4% 72.7% 72.7% V5 0_1ins123;772_1077del n/a
Download CSV