Transcript: Human XM_017026402.1

PREDICTED: Homo sapiens death effector domain containing 2 (DEDD2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DEDD2 (162989)
Length:
2058
CDS:
118..1218

Additional Resources:

NCBI RefSeq record:
XM_017026402.1
NBCI Gene record:
DEDD2 (162989)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166473 CAAATTCTCAGCAGGGTCAGT pLKO.1 536 CDS 100% 2.640 3.696 N DEDD2 n/a
2 TRCN0000250060 ATGCTGTCGCTTCACCGTATG pLKO_005 184 CDS 100% 6.000 4.800 N Dedd2 n/a
3 TRCN0000164876 GTCTCCAGAACGCTATAGCTA pLKO.1 447 CDS 100% 3.000 2.400 N DEDD2 n/a
4 TRCN0000159755 GCACATTGTATCTCTGATCTT pLKO.1 1526 3UTR 100% 4.950 3.465 N DEDD2 n/a
5 TRCN0000164940 GCAGTCAAGCAGTTCTGCAAA pLKO.1 519 CDS 100% 4.950 3.465 N DEDD2 n/a
6 TRCN0000165519 GCACACACTTCTTTGGCCTAA pLKO.1 1642 3UTR 100% 4.050 2.835 N DEDD2 n/a
7 TRCN0000161569 GCTGAACATAGACTTGCACTT pLKO.1 1849 3UTR 100% 4.050 2.835 N DEDD2 n/a
8 TRCN0000166158 CAAGTTCTCAGAGCTCTCCTA pLKO.1 990 CDS 100% 2.640 1.848 N DEDD2 n/a
9 TRCN0000166134 CAGAACGCTATAGCTATGGCA pLKO.1 452 CDS 100% 0.750 0.525 N DEDD2 n/a
10 TRCN0000166424 CAGCTCTTCAAAGAGGACAGA pLKO.1 477 CDS 100% 2.640 1.584 N DEDD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05122 pDONR223 100% 88.8% 89% None 589_708del;858T>C;927C>T n/a
2 ccsbBroad304_05122 pLX_304 0% 88.8% 89% V5 589_708del;858T>C;927C>T n/a
3 TRCN0000478644 CACTAGAAGGCTCACCATTACCCT pLX_317 21.7% 88.8% 89% V5 589_708del;858T>C;927C>T n/a
4 TRCN0000469081 TTCTGATTTTAACTGGTTACGTTA pLX_317 70.7% 50.4% 50.5% V5 (not translated due to frame shift) 433_447del;570_1098del n/a
5 ccsbBroadEn_16115 pDONR223 0% 50.4% 49.4% None 433_447del;557_558insG;570_1098del n/a
6 ccsbBroad304_16115 pLX_304 0% 50.4% 49.4% V5 433_447del;557_558insG;570_1098del n/a
Download CSV