Transcript: Human XM_017026670.2

PREDICTED: Homo sapiens solute carrier family 25 member 42 (SLC25A42), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A42 (284439)
Length:
3371
CDS:
204..1352

Additional Resources:

NCBI RefSeq record:
XM_017026670.2
NBCI Gene record:
SLC25A42 (284439)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141106 CTACAAAGGCTTGAGCATGAA pLKO.1 1247 CDS 100% 4.950 3.960 N SLC25A42 n/a
2 TRCN0000139515 CTTCACCTATGAGACGCTCAA pLKO.1 1010 CDS 100% 4.050 3.240 N SLC25A42 n/a
3 TRCN0000139858 CAAGAGCTTGCACAGAGAGTA pLKO.1 1028 CDS 100% 4.950 3.465 N SLC25A42 n/a
4 TRCN0000110849 CAGCAACATCTTTCATGTCTT pLKO.1 896 CDS 100% 4.950 3.465 N Slc25a42 n/a
5 TRCN0000144548 CAGCAACATCTTTCATGTCTT pLKO.1 896 CDS 100% 4.950 3.465 N SLC25A42 n/a
6 TRCN0000139133 CCTGAGCTTCTTCACCTATGA pLKO.1 1001 CDS 100% 4.950 3.465 N SLC25A42 n/a
7 TRCN0000145296 GTACAGCAACATCTTTCATGT pLKO.1 893 CDS 100% 4.950 3.465 N SLC25A42 n/a
8 TRCN0000139833 CCTCTACTACACCTACCTCAA pLKO.1 623 CDS 100% 4.050 2.835 N SLC25A42 n/a
9 TRCN0000139172 CCCGAAGGAAATGTACAGCAA pLKO.1 881 CDS 100% 2.640 1.848 N SLC25A42 n/a
10 TRCN0000142379 GAAGACTCTCTACCATGGATT pLKO.1 944 CDS 100% 4.950 2.970 N SLC25A42 n/a
11 TRCN0000142274 GTGAGACCAAATGAGTGGATT pLKO.1 3032 3UTR 100% 4.950 2.970 N SLC25A42 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09964 pDONR223 100% 83% 82.7% None 1_192del;307T>C;1126C>A n/a
2 ccsbBroad304_09964 pLX_304 0% 83% 82.7% V5 1_192del;307T>C;1126C>A n/a
3 TRCN0000477065 TTGGAGACCAACTTCGTAATGTTG pLX_317 36.7% 83% 82.7% V5 1_192del;307T>C;1126C>A n/a
Download CSV