Transcript: Human XM_017026923.2

PREDICTED: Homo sapiens sterile alpha motif domain containing 4B (SAMD4B), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD4B (55095)
Length:
10435
CDS:
5965..8043

Additional Resources:

NCBI RefSeq record:
XM_017026923.2
NBCI Gene record:
SAMD4B (55095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026923.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412300 GTGGGCTGGCTCAGCTATATA pLKO_005 8344 3UTR 100% 15.000 21.000 N SAMD4B n/a
2 TRCN0000005451 CGCACTAGAGATGCAGAACTA pLKO.1 7578 CDS 100% 4.950 6.930 N SAMD4B n/a
3 TRCN0000189655 CGAGGAGAACATCACCAGTTA pLKO.1 7440 CDS 100% 4.950 3.960 N Samd4b n/a
4 TRCN0000314326 CGAGGAGAACATCACCAGTTA pLKO_005 7440 CDS 100% 4.950 3.960 N Samd4b n/a
5 TRCN0000433715 GCTCAGAAACATTTGACATTT pLKO_005 8649 3UTR 100% 13.200 9.240 N SAMD4B n/a
6 TRCN0000005452 GAGTCTCAGAACGTCACCAAA pLKO.1 6973 CDS 100% 4.950 3.465 N SAMD4B n/a
7 TRCN0000005449 GCCTACTCAATCGAGAGCAAT pLKO.1 6292 CDS 100% 4.950 3.465 N SAMD4B n/a
8 TRCN0000005448 CCAGAGACAAACTGACCACTA pLKO.1 8615 3UTR 100% 4.050 2.835 N SAMD4B n/a
9 TRCN0000005450 GCATGAAAGATGTGCCCTCAT pLKO.1 6863 CDS 100% 4.050 2.835 N SAMD4B n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5702 5UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5739 5UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5739 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026923.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03521 pDONR223 100% 99.1% 97.7% None (many diffs) n/a
2 ccsbBroad304_03521 pLX_304 0% 99.1% 97.7% V5 (many diffs) n/a
3 TRCN0000467741 TCCACCTAGTCGGGTTCTTTAGTG pLX_317 15.3% 99.1% 97.7% V5 (many diffs) n/a
Download CSV