Transcript: Human XM_017026992.1

PREDICTED: Homo sapiens calcium binding protein 5 (CABP5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CABP5 (56344)
Length:
2029
CDS:
1..855

Additional Resources:

NCBI RefSeq record:
XM_017026992.1
NBCI Gene record:
CABP5 (56344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000446731 AGACCCAGAGCGGTATCTTTG pLKO_005 1009 3UTR 100% 10.800 15.120 N CABP5 n/a
2 TRCN0000056336 GAGTTCGATAAGGACCGAGAT pLKO.1 448 CDS 100% 4.050 5.670 N CABP5 n/a
3 TRCN0000413623 TCAAGGAGTTTGACACGAATG pLKO_005 674 CDS 100% 6.000 4.200 N CABP5 n/a
4 TRCN0000056335 CACAGTTGACTTTGAAGAGTT pLKO.1 813 CDS 100% 4.950 3.465 N CABP5 n/a
5 TRCN0000056333 CCACTGGGACAAGATGAGATT pLKO.1 403 CDS 100% 4.950 3.465 N CABP5 n/a
6 TRCN0000056337 CCCACGGAGATGGAACTGATT pLKO.1 523 CDS 100% 4.950 3.465 N CABP5 n/a
7 TRCN0000056334 CCAGCAAATCCGCATGAACTT pLKO.1 552 CDS 100% 4.950 3.465 N CABP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03721 pDONR223 100% 60.5% 60.2% None (many diffs) n/a
2 ccsbBroad304_03721 pLX_304 0% 60.5% 60.2% V5 (many diffs) n/a
3 TRCN0000469253 ACTTCCATTGTTTATTGGACCATC pLX_317 77.6% 60.5% 60.2% V5 (many diffs) n/a
Download CSV