Transcript: Human XM_017027318.2

PREDICTED: Homo sapiens zinc finger protein 442 (ZNF442), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF442 (79973)
Length:
2753
CDS:
544..2427

Additional Resources:

NCBI RefSeq record:
XM_017027318.2
NBCI Gene record:
ZNF442 (79973)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015728 CGAAGACACATAATAGTACAA pLKO.1 1132 CDS 100% 4.950 6.930 N ZNF442 n/a
2 TRCN0000015732 CAATATGATTCAGTAGCCTTT pLKO.1 616 CDS 100% 4.050 5.670 N ZNF442 n/a
3 TRCN0000431082 TGAAAGTCGCCAGCCAGATAG pLKO_005 834 CDS 100% 10.800 8.640 N ZNF442 n/a
4 TRCN0000418892 TTGTAAAGCCTTCCCTATTTA pLKO_005 1269 CDS 100% 15.000 10.500 N ZNF442 n/a
5 TRCN0000015729 CCTGACTCTCAGACTAATGAA pLKO.1 586 CDS 100% 5.625 3.938 N ZNF442 n/a
6 TRCN0000015730 GAGCCTAAGATGTCATATCAT pLKO.1 801 CDS 100% 5.625 3.938 N ZNF442 n/a
7 TRCN0000015731 GCCTTCATTTATCCCAGTGTA pLKO.1 1780 CDS 100% 4.950 3.465 N ZNF442 n/a
8 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1909 CDS 100% 15.000 7.500 Y ZNF443 n/a
9 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1909 CDS 100% 15.000 7.500 Y Zfp97 n/a
10 TRCN0000218137 CAGTTCCTTGCATAGACATAA pLKO_005 2379 CDS 100% 13.200 6.600 Y ZNF443 n/a
11 TRCN0000018221 CCTATCTAAGACATGAAAGAA pLKO.1 1295 CDS 100% 5.625 2.813 Y ZNF443 n/a
12 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1491 CDS 100% 13.200 6.600 Y Zfp977 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 9 5UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 2344 CDS 100% 4.050 2.025 Y ZNF700 n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 9 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027318.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05002 pDONR223 100% 61.5% 54.6% None (many diffs) n/a
2 ccsbBroad304_05002 pLX_304 0% 61.5% 54.6% V5 (many diffs) n/a
3 TRCN0000481100 ACGCTTAGGCTAATGTCCTTGTGC pLX_317 27.2% 61.5% 54.6% V5 (many diffs) n/a
Download CSV