Transcript: Human XM_017028255.1

PREDICTED: Homo sapiens adenosine deaminase RNA specific B1 (ADARB1), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADARB1 (104)
Length:
11941
CDS:
5473..7578

Additional Resources:

NCBI RefSeq record:
XM_017028255.1
NBCI Gene record:
ADARB1 (104)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028255.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428086 GAGCTAGGAATGTGGTTTATA pLKO_005 7962 3UTR 100% 15.000 21.000 N ADARB1 n/a
2 TRCN0000434376 ACCAGCGGATCTCCAACATAG pLKO_005 7154 CDS 100% 10.800 15.120 N ADARB1 n/a
3 TRCN0000419000 GATAGACACCCAAATCGTAAA pLKO_005 6877 CDS 100% 10.800 15.120 N ADARB1 n/a
4 TRCN0000430914 CTCCGCTATTGAGGTCATCAA pLKO_005 7290 CDS 100% 4.950 6.930 N ADARB1 n/a
5 TRCN0000418205 GATCGTGGCCTTGCATTAAAT pLKO_005 6625 CDS 100% 15.000 10.500 N ADARB1 n/a
6 TRCN0000050940 CGGAGATCCTTGCTCAGATTT pLKO.1 6670 CDS 100% 13.200 9.240 N ADARB1 n/a
7 TRCN0000428598 CTTTCGTTCAGTTTCCTAATG pLKO_005 5894 CDS 100% 10.800 7.560 N ADARB1 n/a
8 TRCN0000436281 TGAAGGAGAATGTCCAGTTTC pLKO_005 6779 CDS 100% 10.800 7.560 N ADARB1 n/a
9 TRCN0000424976 TTATACACAACTTGAGCTTTA pLKO_005 6693 CDS 100% 10.800 7.560 N ADARB1 n/a
10 TRCN0000050941 CCACTTACTACGCTCCAAGAT pLKO.1 7407 CDS 100% 4.950 3.465 N ADARB1 n/a
11 TRCN0000050942 CCCAGGACTCAAGTATGACTT pLKO.1 6204 CDS 100% 4.950 3.465 N ADARB1 n/a
12 TRCN0000050938 GCCAGAATCTTCTCACCACAT pLKO.1 6832 CDS 100% 4.050 2.835 N ADARB1 n/a
13 TRCN0000050939 CCCGTGATGATCTTGAACGAA pLKO.1 6178 CDS 100% 3.000 2.100 N ADARB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028255.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05771 pDONR223 100% 99.9% 99.8% None 671T>C;1962G>A n/a
2 ccsbBroad304_05771 pLX_304 0% 99.9% 99.8% V5 671T>C;1962G>A n/a
3 TRCN0000480349 GCGGACAATTTATAATCGTCATTG pLX_317 18% 99.9% 99.8% V5 671T>C;1962G>A n/a
Download CSV