Construct: ORF TRCN0000480349
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011074.1_s317c1
- Derived from:
- ccsbBroadEn_05771
- DNA Barcode:
- GCGGACAATTTATAATCGTCATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ADARB1 (104)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480349
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NM_001112.4 | 99.9% | 99.8% | 671T>C;1962G>A |
| 2 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028255.1 | 99.9% | 99.8% | 671T>C;1962G>A |
| 3 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NM_001160230.2 | 96% | 95.7% | (many diffs) |
| 4 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NM_001346688.1 | 96% | 95.7% | (many diffs) |
| 5 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NM_015833.4 | 94.5% | 94.4% | 671T>C;1395_1514del;2082G>A |
| 6 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028247.1 | 94.5% | 94.4% | 671T>C;1395_1514del;2082G>A |
| 7 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028248.1 | 94.5% | 94.4% | 671T>C;1395_1514del;2082G>A |
| 8 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028249.1 | 94.5% | 94.4% | 671T>C;1395_1514del;2082G>A |
| 9 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028250.1 | 94.5% | 94.4% | 671T>C;1395_1514del;2082G>A |
| 10 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028251.1 | 94.5% | 94.4% | 671T>C;1395_1514del;2082G>A |
| 11 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028245.2 | 93.3% | 93.3% | 1_147del;818T>C;2109G>A |
| 12 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_006723954.2 | 91% | 91% | (many diffs) |
| 13 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028243.1 | 91% | 91% | (many diffs) |
| 14 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NM_015834.4 | 90.8% | 90.5% | (many diffs) |
| 15 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028254.1 | 90.8% | 90.5% | (many diffs) |
| 16 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_011529425.2 | 90.7% | 90.6% | (many diffs) |
| 17 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028253.2 | 89.7% | 89.4% | (many diffs) |
| 18 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028242.2 | 88.6% | 88.6% | (many diffs) |
| 19 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028246.1 | 87.5% | 87.2% | (many diffs) |
| 20 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_024452043.1 | 85.7% | 84% | (many diffs) |
| 21 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_017028244.2 | 85.1% | 84.9% | (many diffs) |
| 22 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NM_001346687.2 | 81.4% | 79.7% | (many diffs) |
| 23 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NR_144483.2 | 57.7% | (many diffs) | |
| 24 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XM_011529432.1 | 46.5% | 46.5% | 0_1ins1068;327_446del;1014G>A |
| 25 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NR_027674.2 | 42.5% | (many diffs) | |
| 26 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XR_001754792.2 | 41.8% | (many diffs) | |
| 27 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NR_073200.2 | 41.5% | (many diffs) | |
| 28 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NR_027673.1 | 41.4% | (many diffs) | |
| 29 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XR_001754791.2 | 41.4% | (many diffs) | |
| 30 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XR_001754787.2 | 38.6% | (many diffs) | |
| 31 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XR_001754793.2 | 37.9% | (many diffs) | |
| 32 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | NR_027672.2 | 32.2% | (many diffs) | |
| 33 | human | 104 | ADARB1 | adenosine deaminase RNA spe... | XR_001754786.2 | 31.2% | (many diffs) | |
| 34 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | NM_130895.3 | 87.7% | 94.8% | (many diffs) |
| 35 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | XM_006513065.1 | 86.7% | 93.4% | (many diffs) |
| 36 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | NM_001024837.2 | 86.5% | 93.5% | (many diffs) |
| 37 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | XM_006513064.1 | 85.6% | 92.1% | (many diffs) |
| 38 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | XM_006513063.3 | 80.3% | 86.9% | (many diffs) |
| 39 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | XM_006513062.3 | 79.3% | 85.8% | (many diffs) |
| 40 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | NR_021486.1 | 27.8% | (many diffs) | |
| 41 | mouse | 110532 | Adarb1 | adenosine deaminase, RNA-sp... | NR_004429.1 | 27.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2169
- ORF length:
- 2103
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga tatagaagat gaagaaaaca tgagttccag cagcactgat gtgaaggaaa 121 accgcaatct ggacaacgtg tcccccaagg atggcagcac acctgggcct ggcgagggct 181 ctcagctctc caatgggggt ggtggtggcc ccggcagaaa gcggcccctg gaggagggca 241 gcaatggcca ctccaagtac cgcctgaaga aaaggaggaa aacaccaggg cccgtcctcc 301 ccaagaacgc cctgatgcag ctgaatgaga tcaagcctgg tttgcagtac acactcctgt 361 cccagactgg gcccgtgcac gcgcctttgt ttgtcatgtc tgtggaggtg aatggccagg 421 tttttgaggg ctctggtccc acaaagaaaa aggcaaaact ccatgctgct gagaaggcct 481 tgaggtcttt cgttcagttt cctaatgcct ctgaggccca cctggccatg gggaggaccc 541 tgtctgtcaa cacggacttc acatctgacc aggccgactt ccctgacacg ctcttcaatg 601 gttttgaaac tcctgacaag gcggagcctc ccttttacgt gggctccaat ggggatgact 661 ccttcagttc cagcggggac ctcagcttgt ctgcttcccc ggtgcctgcc agcctagccc 721 agcctcctct ccctgcctta ccaccattcc cacccccgag tgggaagaat cccgtgatga 781 tcttgaacga actgcgccca ggactcaagt atgacttcct ctccgagagc ggggagagcc 841 atgccaagag cttcgtcatg tctgtggtcg tggatggtca gttctttgaa ggctcgggga 901 gaaacaagaa gcttgccaag gcccgggctg cgcagtctgc cctggccgcc atttttaact 961 tgcacttgga tcagacgcca tctcgccagc ctattcccag tgagggtctt cagctgcatt 1021 taccgcaggt tttagctgac gctgtctcac gcctggtcct gggtaagttt ggtgacctga 1081 ccgacaactt ctcctcccct cacgctcgca gaaaagtgct ggctggagtc gtcatgacaa 1141 caggcacaga tgttaaagat gccaaggtga taagtgtttc tacaggaaca aaatgtatta 1201 atggtgaata catgagtgat cgtggccttg cattaaatga ctgccatgca gaaataatat 1261 ctcggagatc cttgctcaga tttctttata cacaacttga gctttactta aataacaaag 1321 atgatcaaaa aagatccatc tttcagaaat cagagcgagg ggggtttagg ctgaaggaga 1381 atgtccagtt tcatctgtac atcagcacct ctccctgtgg agatgccaga atcttctcac 1441 cacatgagcc aatcctggaa gaaccagcag atagacaccc aaatcgtaaa gcaagaggac 1501 agctacggac caaaatagag tctggtgagg ggacgattcc agtgcgctcc aatgcgagca 1561 tccaaacgtg ggacggggtg ctgcaagggg agcggctgct caccatgtcc tgcagtgaca 1621 agattgcacg ctggaacgtg gtgggcatcc agggatccct gctcagcatt ttcgtggagc 1681 ccatttactt ctcgagcatc atcctgggca gcctttacca cggggaccac ctttccaggg 1741 ccatgtacca gcggatctcc aacatagagg acctgccacc tctctacacc ctcaaCAAGC 1801 CTTTGCTCAG TGGCATCAGC AATGCAGAAG CACGGCAGCC AGGGAAGGCC CCCAACTTCA 1861 GTGTCAACTG GACGGTAGGC GACTCCGCTA TTGAGGTCAT CAACGCCACG ACTGGGAAGG 1921 ATGAGCTGGG CCGCGCGTCC CGCCTGTGTA AGCACGCGTT GTACTGTCGC TGGATGCGTG 1981 TGCACGGCAA GGTTCCCTCC CACTTACTAC GCTCCAAGAT TACCAAACCC AACGTGTACC 2041 ATGAGTCCAA GCTGGCGGCA AAGGAGTACC AGGCCGCCAA GGCGCGTCTG TTCACAGCCT 2101 TCATCAAGGC GGGGCTGGGG GCCTGGGTGG AGAAGCCCAC CGAGCAGGAC CAGTTCTCAC 2161 TCACGCCCTG CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 2221 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 2281 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAGCGGAC AATTTATAAT CGTCATTGAC 2341 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt