Transcript: Human XM_017028703.1

PREDICTED: Homo sapiens plexin B2 (PLXNB2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLXNB2 (23654)
Length:
6434
CDS:
193..5709

Additional Resources:

NCBI RefSeq record:
XM_017028703.1
NBCI Gene record:
PLXNB2 (23654)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048188 GCTCTACCAATACACGCAGAA pLKO.1 5571 CDS 100% 4.050 5.670 N PLXNB2 n/a
2 TRCN0000300489 GCTCTACCAATACACGCAGAA pLKO_005 5571 CDS 100% 4.050 5.670 N PLXNB2 n/a
3 TRCN0000381500 AGCATCTTCCTCTGAGCAATA pLKO_005 5871 3UTR 100% 10.800 7.560 N PLXNB2 n/a
4 TRCN0000381195 GCAAGTTCCCAGATCCTATGT pLKO_005 6107 3UTR 100% 4.950 3.465 N PLXNB2 n/a
5 TRCN0000048189 GCAGAAGTACTATGACGAGAT pLKO.1 5586 CDS 100% 4.050 2.835 N PLXNB2 n/a
6 TRCN0000300549 GCAGAAGTACTATGACGAGAT pLKO_005 5586 CDS 100% 4.050 2.835 N PLXNB2 n/a
7 TRCN0000048191 ACTGGAGAACAAGGTCACTGA pLKO.1 5682 CDS 100% 2.640 1.848 N PLXNB2 n/a
8 TRCN0000048192 TGACGAGATCATCAATGCCTT pLKO.1 5598 CDS 100% 2.640 1.848 N PLXNB2 n/a
9 TRCN0000331237 TGACGAGATCATCAATGCCTT pLKO_005 5598 CDS 100% 2.640 1.848 N PLXNB2 n/a
10 TRCN0000048190 CAAGAAGATGGTGGAGGATTA pLKO.1 5436 CDS 100% 10.800 6.480 N PLXNB2 n/a
11 TRCN0000300490 CAAGAAGATGGTGGAGGATTA pLKO_005 5436 CDS 100% 10.800 6.480 N PLXNB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15020 pDONR223 100% 25.4% 23.8% None (many diffs) n/a
2 ccsbBroad304_15020 pLX_304 0% 25.4% 23.8% V5 (many diffs) n/a
3 TRCN0000471923 GACCCGCTTCGCATAAACTTACGT pLX_317 23.5% 25.4% 23.8% V5 (many diffs) n/a
Download CSV