Transcript: Human XM_017028909.1

PREDICTED: Homo sapiens ceramide kinase (CERK), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CERK (64781)
Length:
4242
CDS:
16..1518

Additional Resources:

NCBI RefSeq record:
XM_017028909.1
NBCI Gene record:
CERK (64781)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195338 CCGCTAGATAGGCTCTGATTT pLKO.1 3853 3UTR 100% 13.200 18.480 N CERK n/a
2 TRCN0000194889 CGGCTTAAACTTTGATCTGTA pLKO.1 2721 3UTR 100% 4.950 6.930 N CERK n/a
3 TRCN0000199644 GCGTCTCGGATGTCTGTCTTT pLKO.1 2503 3UTR 100% 4.950 6.930 N CERK n/a
4 TRCN0000199185 CGACGCGAAGTGCTTAACACA pLKO.1 2288 3UTR 100% 3.000 4.200 N CERK n/a
5 TRCN0000037688 GCCACGATGGATCGCTGGTTT pLKO.1 2533 3UTR 100% 1.650 2.310 N CERK n/a
6 TRCN0000289241 GCCACGATGGATCGCTGGTTT pLKO_005 2533 3UTR 100% 1.650 2.310 N CERK n/a
7 TRCN0000199723 GCCTGAAGTCTGTACACGTGG pLKO.1 2396 3UTR 100% 0.720 1.008 N CERK n/a
8 TRCN0000199620 GCTACGACAATCCGGCTGGGA pLKO.1 2153 3UTR 100% 0.000 0.000 N CERK n/a
9 TRCN0000037685 CACACTGAGTTCTCTATATTT pLKO.1 2442 3UTR 100% 15.000 10.500 N CERK n/a
10 TRCN0000289240 CACACTGAGTTCTCTATATTT pLKO_005 2442 3UTR 100% 15.000 10.500 N CERK n/a
11 TRCN0000195297 CCCTTAGTGATTTCATGTTTA pLKO.1 2818 3UTR 100% 13.200 9.240 N CERK n/a
12 TRCN0000296196 CCCTTAGTGATTTCATGTTTA pLKO_005 2818 3UTR 100% 13.200 9.240 N CERK n/a
13 TRCN0000195155 CCTGAATACAATCTTGAGTAA pLKO.1 4098 3UTR 100% 4.950 3.465 N CERK n/a
14 TRCN0000037684 CTGGCAAGTTTGTTACTGTTA pLKO.1 2241 3UTR 100% 4.950 3.465 N CERK n/a
15 TRCN0000289316 CTGGCAAGTTTGTTACTGTTA pLKO_005 2241 3UTR 100% 4.950 3.465 N CERK n/a
16 TRCN0000037686 TCCAGATTTGTCCTTGTCTTT pLKO.1 2417 3UTR 100% 4.950 3.465 N CERK n/a
17 TRCN0000037687 CACGGATGATAAGCTCTGGAA pLKO.1 2201 3UTR 100% 2.640 1.848 N CERK n/a
18 TRCN0000199448 GCTGGCAGTGTGTAAAGCACT pLKO.1 2222 3UTR 100% 2.640 1.848 N CERK n/a
19 TRCN0000310209 GCTGGCAGTGTGTAAAGCACT pLKO_005 2222 3UTR 100% 2.640 1.848 N CERK n/a
20 TRCN0000199885 GCGGCGAGGCTACGACAATCC pLKO.1 2145 3UTR 100% 0.000 0.000 N CERK n/a
21 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3301 3UTR 100% 4.950 2.475 Y ERAP2 n/a
22 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3302 3UTR 100% 13.200 6.600 Y LIAS n/a
23 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3468 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028909.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487882 ATGTCATAAATAATTCATTCATCT pLX_317 20.1% 92.3% 91.6% V5 (many diffs) n/a
2 TRCN0000488156 ATCAAAAGTCGAGTTTGTGCACTG pLX_317 20.3% 92.3% 91.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV