Transcript: Human XM_017029413.2

PREDICTED: Homo sapiens glypican 3 (GPC3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GPC3 (2719)
Length:
1643
CDS:
168..1628

Additional Resources:

NCBI RefSeq record:
XM_017029413.2
NBCI Gene record:
GPC3 (2719)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029413.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109458 GCCAATATAGATCTGCTTATT pLKO.1 1231 CDS 100% 13.200 18.480 N Gpc3 n/a
2 TRCN0000078562 GCCTGTTTCCAGTCATCTATA pLKO.1 685 CDS 100% 13.200 18.480 N GPC3 n/a
3 TRCN0000315782 GCCTGTTTCCAGTCATCTATA pLKO_005 685 CDS 100% 13.200 18.480 N GPC3 n/a
4 TRCN0000078559 CCTGAAAGTATTTGGGAATTT pLKO.1 779 CDS 100% 13.200 9.240 N GPC3 n/a
5 TRCN0000315781 CCTGAAAGTATTTGGGAATTT pLKO_005 779 CDS 100% 13.200 9.240 N GPC3 n/a
6 TRCN0000109457 GCTCAAGAAAGATGGAAGAAA pLKO.1 385 CDS 100% 5.625 3.938 N Gpc3 n/a
7 TRCN0000316587 GCTCAAGAAAGATGGAAGAAA pLKO_005 385 CDS 100% 5.625 3.938 N Gpc3 n/a
8 TRCN0000078560 CCCATTCTCAACAACGCCAAT pLKO.1 1216 CDS 100% 4.050 2.835 N GPC3 n/a
9 TRCN0000315860 CCCATTCTCAACAACGCCAAT pLKO_005 1216 CDS 100% 4.050 2.835 N GPC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029413.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06280 pDONR223 100% 78.5% 76.5% None (many diffs) n/a
2 ccsbBroad304_06280 pLX_304 0% 78.5% 76.5% V5 (many diffs) n/a
3 TRCN0000466793 ATTACATATTATCTTGTGATCTCA pLX_317 21.9% 78.5% 76.5% V5 (many diffs) n/a
Download CSV