Transcript: Human XM_017029546.1

PREDICTED: Homo sapiens moesin (MSN), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MSN (4478)
Length:
4010
CDS:
272..1972

Additional Resources:

NCBI RefSeq record:
XM_017029546.1
NBCI Gene record:
MSN (4478)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062411 GCATTGACGAATTTGAGTCTA pLKO.1 1947 CDS 100% 4.950 6.930 N MSN n/a
2 TRCN0000333263 GCATTGACGAATTTGAGTCTA pLKO_005 1947 CDS 100% 4.950 6.930 N MSN n/a
3 TRCN0000062412 GCGGATTAACAAGCGGATCTT pLKO.1 1060 CDS 100% 4.950 6.930 N MSN n/a
4 TRCN0000333262 GCGGATTAACAAGCGGATCTT pLKO_005 1060 CDS 100% 4.950 6.930 N MSN n/a
5 TRCN0000062409 CCAGTCTAAGTATGGCGACTT pLKO.1 628 CDS 100% 4.050 5.670 N MSN n/a
6 TRCN0000062410 GCTCTTTAAGTTCCGTGCCAA pLKO.1 466 CDS 100% 2.640 3.696 N MSN n/a
7 TRCN0000344732 ACCACCGGGAAGCAGCTATTT pLKO_005 308 CDS 100% 13.200 10.560 N MSN n/a
8 TRCN0000062408 GCTAAATTGAAACCTGGAATT pLKO.1 3803 3UTR 100% 0.000 0.000 N MSN n/a
9 TRCN0000333264 GCTAAATTGAAACCTGGAATT pLKO_005 3803 3UTR 100% 0.000 0.000 N MSN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13902 pDONR223 100% 98% 97.5% None 0_1ins33;1691_1692insG n/a
2 ccsbBroad304_13902 pLX_304 0% 98% 97.5% V5 (not translated due to frame shift) 0_1ins33;1691_1692insG n/a
3 TRCN0000478804 AATCCAATAAAGGAAATGGTGGTA pLX_317 26.3% 98% 97.5% V5 (not translated due to prior stop codon) 0_1ins33;1691_1692insG n/a
Download CSV