Transcript: Human XM_017029556.1

PREDICTED: Homo sapiens ornithine carbamoyltransferase (OTC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTC (5009)
Length:
1123
CDS:
170..1105

Additional Resources:

NCBI RefSeq record:
XM_017029556.1
NBCI Gene record:
OTC (5009)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416936 GAAGCATCCATCCCAATTATC pLKO_005 629 CDS 100% 13.200 18.480 N OTC n/a
2 TRCN0000412388 CACAACTTCATGGTTCGAAAT pLKO_005 221 CDS 100% 10.800 15.120 N OTC n/a
3 TRCN0000035099 CGAGTGTATAAACAATCAGAT pLKO.1 590 CDS 100% 4.950 6.930 N OTC n/a
4 TRCN0000035100 CCGTGACCTTCTCACTCTAAA pLKO.1 286 CDS 100% 13.200 10.560 N OTC n/a
5 TRCN0000035103 GTCAGATTTGTACCATCCTAT pLKO.1 658 CDS 100% 4.950 3.960 N OTC n/a
6 TRCN0000035102 GTTGCTGACAAATGATCCATT pLKO.1 901 CDS 100% 4.950 3.960 N OTC n/a
7 TRCN0000035101 CGAACAAGATTGTCTACAGAA pLKO.1 443 CDS 100% 4.950 3.465 N OTC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029556.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01127 pDONR223 100% 84.2% 83.6% None (many diffs) n/a
2 ccsbBroad304_01127 pLX_304 0% 84.2% 83.6% V5 (many diffs) n/a
3 TRCN0000477562 AAATCAGATCTAGTCTCTTGGACG pLX_317 38.7% 84.2% 83.6% V5 (many diffs) n/a
Download CSV