Transcript: Human XM_017029796.1

PREDICTED: Homo sapiens zinc finger protein X-linked (ZFX), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFX (7543)
Length:
7184
CDS:
78..2471

Additional Resources:

NCBI RefSeq record:
XM_017029796.1
NBCI Gene record:
ZFX (7543)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219096 TGTTATTGAGGACGTTGTTAT pLKO_005 392 CDS 100% 13.200 18.480 N ZFX n/a
2 TRCN0000234346 ACACGTCTTGACGGGTGATTC pLKO_005 587 CDS 100% 10.800 15.120 N ZFX n/a
3 TRCN0000221678 GTCGGAAATTGATCCTTGTAA pLKO.1 899 CDS 100% 5.625 7.875 N ZFX n/a
4 TRCN0000221680 GACGTTGTTATAGAAGATGTT pLKO.1 402 CDS 100% 4.950 6.930 N ZFX n/a
5 TRCN0000234349 AGTCAGGTCTAATTATCATAA pLKO_005 2931 3UTR 100% 13.200 9.240 N ZFX n/a
6 TRCN0000234348 AGTTGGCCTGCCCTAACAATA pLKO_005 2456 CDS 100% 13.200 9.240 N ZFX n/a
7 TRCN0000221679 AGTGATTTGAAACGACACATA pLKO.1 1989 CDS 100% 4.950 3.465 N ZFX n/a
8 TRCN0000221677 CCAATCAGTCTCATTCACATA pLKO.1 2533 3UTR 100% 4.950 3.465 N ZFX n/a
9 TRCN0000221681 GCAGGATGATGACAAAGGCAA pLKO.1 794 CDS 100% 2.640 1.848 N ZFX n/a
10 TRCN0000234347 TGGACACAGAGTCGGAAATTG pLKO_005 889 CDS 100% 13.200 7.920 N ZFX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029796.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01791 pDONR223 100% 81.2% 78.5% None (many diffs) n/a
2 TRCN0000477192 CGGTAAATAATATAGGTCCGTATT pLX_317 20.2% 81.2% 78.5% V5 (many diffs) n/a
Download CSV