Transcript: Human XM_017029845.1

PREDICTED: Homo sapiens LON peptidase N-terminal domain and ring finger 3 (LONRF3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LONRF3 (79836)
Length:
2153
CDS:
168..1877

Additional Resources:

NCBI RefSeq record:
XM_017029845.1
NBCI Gene record:
LONRF3 (79836)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421742 AGCAATCGGTCTCAGATTTAT pLKO_005 1008 CDS 100% 15.000 21.000 N LONRF3 n/a
2 TRCN0000175956 GCACATCTTTGAGCCTTGTTA pLKO.1 1760 CDS 100% 5.625 3.938 N Lonrf3 n/a
3 TRCN0000022426 CACATGAAAGACCAGGAAGAA pLKO.1 1212 CDS 100% 4.950 3.465 N LONRF3 n/a
4 TRCN0000022425 CTGACCTTGAATGCGCTCTAT pLKO.1 1432 CDS 100% 4.950 3.465 N LONRF3 n/a
5 TRCN0000022428 GCCTGATGATTCGTAGATGCA pLKO.1 1783 CDS 100% 2.640 1.584 N LONRF3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15153 pDONR223 94.5% 74.5% 31.2% None (many diffs) n/a
2 ccsbBroad304_15153 pLX_304 0% 74.5% 31.2% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473633 TCATAAGATTACTGACTTCACCCA pLX_317 23.4% 74.5% 31.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV