Transcript: Human XM_017029846.1

PREDICTED: Homo sapiens ALG13 UDP-N-acetylglucosaminyltransferase subunit (ALG13), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALG13 (79868)
Length:
8103
CDS:
477..3938

Additional Resources:

NCBI RefSeq record:
XM_017029846.1
NBCI Gene record:
ALG13 (79868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236275 AGCCACTCGTAGTGGTTATAA pLKO_005 757 CDS 100% 15.000 21.000 N ALG13 n/a
2 TRCN0000034823 GCCACTCGTAGTGGTTATAAA pLKO.1 758 CDS 100% 15.000 21.000 N ALG13 n/a
3 TRCN0000034819 CCTTGGTTACAACCGACTTAT pLKO.1 569 CDS 100% 13.200 18.480 N ALG13 n/a
4 TRCN0000236272 CTTGGTTACAACCGACTTATC pLKO_005 570 CDS 100% 10.800 15.120 N ALG13 n/a
5 TRCN0000034821 CCCTTCAGTACTGAGTCGTTT pLKO.1 624 CDS 100% 4.950 6.930 N ALG13 n/a
6 TRCN0000236276 GTCGTTTACTCTGGATGTTTA pLKO_005 638 CDS 100% 13.200 10.560 N ALG13 n/a
7 TRCN0000183525 GCTTTATATTAGCTGATGGTA pLKO.1 4212 3UTR 100% 3.000 2.400 N ALG13 n/a
8 TRCN0000183416 CTCAAATTCATGGTGCTATAA pLKO.1 3850 CDS 100% 13.200 9.240 N ALG13 n/a
9 TRCN0000181004 GCAGCGGCTAATCAAGCTATT pLKO.1 3126 CDS 100% 10.800 7.560 N ALG13 n/a
10 TRCN0000034822 ACCAGCTTTGACGACCTCATT pLKO.1 507 CDS 100% 4.950 3.465 N ALG13 n/a
11 TRCN0000179842 CCAGTAATGTCAGATCCCTAT pLKO.1 3726 CDS 100% 4.050 2.835 N ALG13 n/a
12 TRCN0000180918 GCAGTGCTATTACCACAGCTA pLKO.1 3494 CDS 100% 2.640 1.848 N ALG13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10253 pDONR223 100% 38.8% 38.8% None (many diffs) n/a
2 ccsbBroad304_10253 pLX_304 0% 38.8% 38.8% V5 (many diffs) n/a
3 ccsbBroadEn_08974 pDONR223 100% 13.3% 11.8% None (many diffs) n/a
4 ccsbBroad304_08974 pLX_304 0% 13.3% 11.8% V5 (many diffs) n/a
5 TRCN0000468097 GAAGCAGCAAATCCCAAGTAACAG pLX_317 69.1% 13.3% 11.8% V5 (many diffs) n/a
Download CSV