Transcript: Human XM_017029969.1

PREDICTED: Homo sapiens synaptotagmin like 4 (SYTL4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYTL4 (94121)
Length:
6396
CDS:
163..2193

Additional Resources:

NCBI RefSeq record:
XM_017029969.1
NBCI Gene record:
SYTL4 (94121)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380663 GATGAGGGTGAGATGATATTT pLKO_005 916 CDS 100% 15.000 21.000 N SYTL4 n/a
2 TRCN0000380287 GAAGCAGGGTTGGTTAGTAAA pLKO_005 2757 3UTR 100% 13.200 18.480 N SYTL4 n/a
3 TRCN0000060308 CCTCACTACAACCATACATTT pLKO.1 1888 CDS 100% 13.200 10.560 N SYTL4 n/a
4 TRCN0000379521 TCTTTCTCCTCTCCAATTTAT pLKO_005 2814 3UTR 100% 15.000 10.500 N SYTL4 n/a
5 TRCN0000381890 ACCGCACAGGTAGTGAGATAA pLKO_005 548 CDS 100% 13.200 9.240 N SYTL4 n/a
6 TRCN0000381740 AGGAGCCCAGTGTGCTATTTG pLKO_005 692 CDS 100% 13.200 9.240 N SYTL4 n/a
7 TRCN0000382492 GGATTCCTGGAAGCTTGATAA pLKO_005 1557 CDS 100% 13.200 9.240 N SYTL4 n/a
8 TRCN0000381014 CCCTGGCTACCTTTCGCATTA pLKO_005 2709 3UTR 100% 10.800 7.560 N SYTL4 n/a
9 TRCN0000382048 GGCGACTAAAGAATGAGTTAC pLKO_005 272 CDS 100% 10.800 7.560 N SYTL4 n/a
10 TRCN0000060310 CCTCCCTTTACATGGAAAGAT pLKO.1 1593 CDS 100% 5.625 3.938 N SYTL4 n/a
11 TRCN0000060311 CGCCAAGGAAATAGAGTTGAA pLKO.1 477 CDS 100% 4.950 3.465 N SYTL4 n/a
12 TRCN0000060312 GAGTACACTAAATCTGTGATA pLKO.1 970 CDS 100% 4.950 3.465 N SYTL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029969.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09367 pDONR223 100% 94.7% 90.5% None (many diffs) n/a
2 ccsbBroad304_09367 pLX_304 0% 94.7% 90.5% V5 (many diffs) n/a
3 TRCN0000477509 TATCCGCCCATCTGACCATCCAAC pLX_317 20.3% 94.7% 90.5% V5 (many diffs) n/a
Download CSV