Transcript: Mouse XM_017312638.1

PREDICTED: Mus musculus neuregulin 1 (Nrg1), transcript variant X20, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nrg1 (211323)
Length:
11385
CDS:
758..2146

Additional Resources:

NCBI RefSeq record:
XM_017312638.1
NBCI Gene record:
Nrg1 (211323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000068233 CCCAGATTGAAAGAGATGAAA pLKO.1 866 CDS 100% 5.625 3.938 N Nrg1 n/a
2 TRCN0000068235 CCTATTAAGAAAGTCACCAAT pLKO.1 2508 3UTR 100% 4.950 3.465 N Nrg1 n/a
3 TRCN0000068237 GCCTCAACTGAAAGACCCTAT pLKO.1 1178 CDS 100% 4.050 2.835 N Nrg1 n/a
4 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9882 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312638.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15442 pDONR223 0% 44.4% 42% None (many diffs) n/a
2 ccsbBroad304_15442 pLX_304 0% 44.4% 42% V5 (many diffs) n/a
3 TRCN0000474665 AGGGGATGGAGGTTCGACCCTCTC pLX_317 66.2% 44.4% 42% V5 (many diffs) n/a
Download CSV