Transcript: Mouse XM_017312901.1

PREDICTED: Mus musculus Rho guanine nucleotide exchange factor (GEF7) (Arhgef7), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgef7 (54126)
Length:
5002
CDS:
921..2570

Additional Resources:

NCBI RefSeq record:
XM_017312901.1
NBCI Gene record:
Arhgef7 (54126)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017312901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303860 AGAGACACATGGAGGATTATC pLKO_005 1420 CDS 100% 13.200 9.240 N ARHGEF7 n/a
2 TRCN0000305803 AGAGACACATGGAGGATTATC pLKO_005 1420 CDS 100% 13.200 9.240 N Arhgef7 n/a
3 TRCN0000110026 CCTGAAGGTTATCGAAGCTTA pLKO.1 2297 CDS 100% 4.950 3.465 N Arhgef7 n/a
4 TRCN0000110027 GAAGTCTATGACGGCCTTCAA pLKO.1 1463 CDS 100% 4.950 3.465 N Arhgef7 n/a
5 TRCN0000353879 GAAGTCTATGACGGCCTTCAA pLKO_005 1463 CDS 100% 4.950 3.465 N Arhgef7 n/a
6 TRCN0000110029 CAGATCCTGAAGGTTATCGAA pLKO.1 2292 CDS 100% 3.000 2.100 N Arhgef7 n/a
7 TRCN0000324966 CAGATCCTGAAGGTTATCGAA pLKO_005 2292 CDS 100% 3.000 2.100 N Arhgef7 n/a
8 TRCN0000047597 CTCTGCTACAAGGAGGATCTT pLKO.1 2157 CDS 100% 4.950 3.465 N ARHGEF7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017312901.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07317 pDONR223 100% 62.7% 66% None (many diffs) n/a
2 ccsbBroad304_07317 pLX_304 0% 62.7% 66% V5 (many diffs) n/a
3 TRCN0000474600 ATGTATAGCGCCCTCCCCCCGCCC pLX_317 16.8% 62.7% 66% V5 (many diffs) n/a
4 ccsbBroadEn_02036 pDONR223 100% 58.9% 62.2% None (many diffs) n/a
5 ccsbBroad304_02036 pLX_304 0% 58.9% 62.2% V5 (many diffs) n/a
6 TRCN0000479549 CAGCCCGAGTTGTATTTCACCCGA pLX_317 16% 58.9% 62.2% V5 (many diffs) n/a
Download CSV