Transcript: Mouse XM_017313521.1

PREDICTED: Mus musculus trafficking protein, kinesin binding 1 (Trak1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trak1 (67095)
Length:
4944
CDS:
355..3024

Additional Resources:

NCBI RefSeq record:
XM_017313521.1
NBCI Gene record:
Trak1 (67095)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294179 TGTACTGCCTTAACGACTTTG pLKO_005 2060 CDS 100% 10.800 15.120 N TRAK1 n/a
2 TRCN0000421920 TGTACTGCCTTAACGACTTTG pLKO_005 2060 CDS 100% 10.800 15.120 N Trak1 n/a
3 TRCN0000126992 CGGTCAGTCATTGTTGAAGAA pLKO.1 597 CDS 100% 4.950 6.930 N Trak1 n/a
4 TRCN0000414662 TCCAATCCACAGGAAGTAATA pLKO_005 3207 3UTR 100% 13.200 9.240 N Trak1 n/a
5 TRCN0000425028 AGACGGTGAGGAACGTCAATC pLKO_005 1406 CDS 100% 10.800 7.560 N Trak1 n/a
6 TRCN0000442834 GATGTCACCTGAGCTCATTTG pLKO_005 3254 3UTR 100% 10.800 7.560 N Trak1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313521.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11645 pDONR223 100% 63.5% 59.8% None (many diffs) n/a
2 ccsbBroad304_11645 pLX_304 0% 63.5% 59.8% V5 (many diffs) n/a
3 TRCN0000479369 CTTCTCATCTAATATCCCAATAAC pLX_317 7.7% 63.5% 59.8% V5 (many diffs) n/a
Download CSV