Transcript: Mouse XM_017313620.1

PREDICTED: Mus musculus mannosidase, alpha, class 2C, member 1 (Man2c1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Man2c1 (73744)
Length:
4403
CDS:
1294..4314

Additional Resources:

NCBI RefSeq record:
XM_017313620.1
NBCI Gene record:
Man2c1 (73744)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077091 GTTTGACCAAAGAAGGCGAAA pLKO.1 371 5UTR 100% 4.050 3.240 N Man2c1 n/a
2 TRCN0000334212 GTTTGACCAAAGAAGGCGAAA pLKO_005 371 5UTR 100% 4.050 3.240 N Man2c1 n/a
3 TRCN0000348295 TGGTGACAGTGCCAAGTATTG pLKO_005 3050 CDS 100% 10.800 7.560 N Man2c1 n/a
4 TRCN0000077088 CCTGCTCAACAACTGCAAGTA pLKO.1 3696 CDS 100% 4.950 3.465 N Man2c1 n/a
5 TRCN0000049612 CGATCTACTTCACCGACTGTA pLKO.1 89 5UTR 100% 4.950 3.465 N MAN2C1 n/a
6 TRCN0000077092 GCTACCTATGAGATCCAGTTT pLKO.1 3568 CDS 100% 4.950 3.465 N Man2c1 n/a
7 TRCN0000334214 GCTACCTATGAGATCCAGTTT pLKO_005 3568 CDS 100% 4.950 3.465 N Man2c1 n/a
8 TRCN0000077090 CCTTCCAAGTGAGATCCCTAT pLKO.1 4265 CDS 100% 4.050 2.835 N Man2c1 n/a
9 TRCN0000077089 CGGTTCTGTGACTTTGGACAA pLKO.1 3150 CDS 100% 4.050 2.835 N Man2c1 n/a
10 TRCN0000334280 CGGTTCTGTGACTTTGGACAA pLKO_005 3150 CDS 100% 4.050 2.835 N Man2c1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313620.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00972 pDONR223 100% 72.1% 73.4% None (many diffs) n/a
2 ccsbBroad304_00972 pLX_304 0% 72.1% 73.4% V5 (many diffs) n/a
3 TRCN0000468851 CATTCGAGTAAATACTCTAGCGTC pLX_317 13.2% 72.1% 73.4% V5 (many diffs) n/a
Download CSV