Transcript: Mouse XM_017313694.1

PREDICTED: Mus musculus male-specific lethal 2 homolog (Drosophila) (Msl2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Msl2 (77853)
Length:
5306
CDS:
1559..3070

Additional Resources:

NCBI RefSeq record:
XM_017313694.1
NBCI Gene record:
Msl2 (77853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243428 ACGACACTGGCACGGGATATA pLKO_005 1673 CDS 100% 13.200 10.560 N Msl2 n/a
2 TRCN0000037029 CCACTTCCAATTTCTACCATT pLKO.1 2396 CDS 100% 4.950 3.960 N MSL2 n/a
3 TRCN0000037030 CGGGATATAATAGAAGCAGTT pLKO.1 1685 CDS 100% 4.050 3.240 N MSL2 n/a
4 TRCN0000243431 AGAAGTTTGCTGTCCTAATTT pLKO_005 2185 CDS 100% 15.000 10.500 N Msl2 n/a
5 TRCN0000243429 CCCAGTCTCTTAGCCATAATG pLKO_005 2259 CDS 100% 13.200 9.240 N Msl2 n/a
6 TRCN0000294337 CCCAGTCTCTTAGCCATAATG pLKO_005 2259 CDS 100% 13.200 9.240 N MSL2 n/a
7 TRCN0000294296 TTGCCGGAGCTCCTGCATATA pLKO_005 3148 3UTR 100% 13.200 9.240 N MSL2 n/a
8 TRCN0000243427 CTGATCCTCAAGCTAGCTTAT pLKO_005 1839 CDS 100% 10.800 7.560 N Msl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313694.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03540 pDONR223 100% 82.7% 86.1% None (many diffs) n/a
2 ccsbBroad304_03540 pLX_304 0% 82.7% 86.1% V5 (many diffs) n/a
3 TRCN0000477741 ATCGTTATCCTTCACCGTTCTGTT pLX_317 18.9% 82.7% 86.1% V5 (many diffs) n/a
Download CSV