Transcript: Mouse XM_017313703.1

PREDICTED: Mus musculus SAC1 suppressor of actin mutations 1-like (yeast) (Sacm1l), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sacm1l (83493)
Length:
3244
CDS:
1..1581

Additional Resources:

NCBI RefSeq record:
XM_017313703.1
NBCI Gene record:
Sacm1l (83493)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081327 CCAGTGTTGCATGGCTTTATT pLKO.1 379 CDS 100% 15.000 21.000 N Sacm1l n/a
2 TRCN0000332363 CCAGTGTTGCATGGCTTTATT pLKO_005 379 CDS 100% 15.000 21.000 N Sacm1l n/a
3 TRCN0000081324 CGGTATTACAAGAACAACTTT pLKO.1 1255 CDS 100% 5.625 7.875 N Sacm1l n/a
4 TRCN0000354209 CGGTATTACAAGAACAACTTT pLKO_005 1255 CDS 100% 5.625 7.875 N Sacm1l n/a
5 TRCN0000062789 CCATAGACTTATTTCTTGGAA pLKO.1 1298 CDS 100% 3.000 4.200 N SACM1L n/a
6 TRCN0000081325 CGAATGTGATACAGAGTTTAT pLKO.1 1004 CDS 100% 13.200 9.240 N Sacm1l n/a
7 TRCN0000332291 CGAATGTGATACAGAGTTTAT pLKO_005 1004 CDS 100% 13.200 9.240 N Sacm1l n/a
8 TRCN0000081323 GCTGTCAATAAGTGTCTGAAA pLKO.1 2513 3UTR 100% 4.950 3.465 N Sacm1l n/a
9 TRCN0000332361 GCTGTCAATAAGTGTCTGAAA pLKO_005 2513 3UTR 100% 4.950 3.465 N Sacm1l n/a
10 TRCN0000081326 GCTTGTGATGATGGAGCAGAT pLKO.1 9 CDS 100% 4.050 2.835 N Sacm1l n/a
11 TRCN0000332364 GCTTGTGATGATGGAGCAGAT pLKO_005 9 CDS 100% 4.050 2.835 N Sacm1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313703.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07814 pDONR223 100% 81.7% 75.4% None (many diffs) n/a
2 ccsbBroad304_07814 pLX_304 0% 81.7% 75.4% V5 (many diffs) n/a
3 TRCN0000466061 CTACCCCATCTGTCTTCAGGGTTG pLX_317 24.4% 81.7% 75.4% V5 (many diffs) n/a
Download CSV