Transcript: Mouse XM_017313800.1

PREDICTED: Mus musculus SEC63-like (S. cerevisiae) (Sec63), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec63 (140740)
Length:
5721
CDS:
382..2244

Additional Resources:

NCBI RefSeq record:
XM_017313800.1
NBCI Gene record:
Sec63 (140740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336302 TGTAATCTGCCAGCTAATAAT pLKO_005 975 CDS 100% 15.000 21.000 N Sec63 n/a
2 TRCN0000216997 CACACGTCTACAGTACTATAA pLKO.1 3420 3UTR 100% 13.200 18.480 N Sec63 n/a
3 TRCN0000336242 TCTTGGTGGTATCGGTCAATA pLKO_005 589 CDS 100% 13.200 18.480 N Sec63 n/a
4 TRCN0000353322 CTGTTAGTAAGCTCTATTATT pLKO_005 2665 3UTR 100% 15.000 12.000 N Sec63 n/a
5 TRCN0000174404 GAAGAGGTAGAACTGAAGTTT pLKO.1 1990 CDS 100% 5.625 3.938 N Sec63 n/a
6 TRCN0000146839 CAAGCCTGGAAATTATCAGTA pLKO.1 2022 CDS 100% 4.950 3.465 N SEC63 n/a
7 TRCN0000193760 CCCTAGTTACAGTGTTGGTTA pLKO.1 1358 CDS 100% 4.950 3.465 N Sec63 n/a
8 TRCN0000175765 GCAACAACATCACAGTAGGAT pLKO.1 1337 CDS 100% 3.000 2.100 N Sec63 n/a
9 TRCN0000174303 CAAGAGTTACAACAGAGTATA pLKO.1 1801 CDS 100% 13.200 7.920 N Sec63 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313800.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07779 pDONR223 100% 74.1% 77.7% None (many diffs) n/a
2 ccsbBroad304_07779 pLX_304 0% 74.1% 77.7% V5 (many diffs) n/a
3 TRCN0000474956 GTCTTAACGAATCCCCGAGTCTTC pLX_317 15.6% 74.1% 77.7% V5 (many diffs) n/a
4 ccsbBroadEn_07778 pDONR223 100% 74.1% 77.8% None (many diffs) n/a
5 TRCN0000478481 TTTCATACATCCCTGAGACGTCTA pLX_317 15.6% 74.1% 77.8% V5 (many diffs) n/a
Download CSV