Transcript: Mouse XM_017314082.1

PREDICTED: Mus musculus GRIP and coiled-coil domain containing 2 (Gcc2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gcc2 (70297)
Length:
6192
CDS:
2715..4757

Additional Resources:

NCBI RefSeq record:
XM_017314082.1
NBCI Gene record:
Gcc2 (70297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099950 GCCGTGTTTATTAAAGGATTA pLKO.1 5161 3UTR 100% 10.800 15.120 N Gcc2 n/a
2 TRCN0000099953 CCCTACAAGAAGAAATAACTT pLKO.1 3286 CDS 100% 5.625 7.875 N Gcc2 n/a
3 TRCN0000099952 GCCAGTATGAAAGACTAACTT pLKO.1 2866 CDS 100% 5.625 7.875 N Gcc2 n/a
4 TRCN0000099951 CGGAACAAACAGTATGTGATA pLKO.1 749 5UTR 100% 4.950 6.930 N Gcc2 n/a
5 TRCN0000099954 CGCTATCCTTATGGAGCAAAT pLKO.1 4460 CDS 100% 10.800 8.640 N Gcc2 n/a
6 TRCN0000147313 GCAAGAATTAGAGCTGGTTAA pLKO.1 3116 CDS 100% 10.800 8.640 N GCC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14023 pDONR223 100% 36.8% 37.5% None (many diffs) n/a
2 ccsbBroad304_14023 pLX_304 0% 36.8% 37.5% V5 (many diffs) n/a
3 TRCN0000477870 CAGGGTCGGGCAAGAATTGAGACT pLX_317 12% 36.8% 37.5% V5 (many diffs) n/a
Download CSV