Transcript: Mouse XM_017314806.1

PREDICTED: Mus musculus eukaryotic translation initiation factor 4E nuclear import factor 1 (Eif4enif1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Eif4enif1 (74203)
Length:
3605
CDS:
238..3117

Additional Resources:

NCBI RefSeq record:
XM_017314806.1
NBCI Gene record:
Eif4enif1 (74203)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175042 GAACAAGATTATCGACCTAAA pLKO.1 2497 CDS 100% 10.800 8.640 N Eif4enif1 n/a
2 TRCN0000175309 CCCAGGAGAATTTGACTTTAA pLKO.1 1137 CDS 100% 13.200 9.240 N Eif4enif1 n/a
3 TRCN0000339954 CCCAGGAGAATTTGACTTTAA pLKO_005 1137 CDS 100% 13.200 9.240 N Eif4enif1 n/a
4 TRCN0000423445 CATGCTTGGCTTCGATGATAG pLKO_005 1184 CDS 100% 10.800 7.560 N EIF4ENIF1 n/a
5 TRCN0000176090 GCACACTATGTGAAGATGTTT pLKO.1 3209 3UTR 100% 5.625 3.938 N Eif4enif1 n/a
6 TRCN0000340295 GCACACTATGTGAAGATGTTT pLKO_005 3209 3UTR 100% 5.625 3.938 N Eif4enif1 n/a
7 TRCN0000194361 CCTTATGTACAGACCTGTGTA pLKO.1 3423 3UTR 100% 4.950 3.465 N Eif4enif1 n/a
8 TRCN0000340296 CCTTATGTACAGACCTGTGTA pLKO_005 3423 3UTR 100% 4.950 3.465 N Eif4enif1 n/a
9 TRCN0000175849 GCTTCGATGATAGAAGATGTT pLKO.1 1192 CDS 100% 4.950 3.465 N Eif4enif1 n/a
10 TRCN0000340294 GCTTCGATGATAGAAGATGTT pLKO_005 1192 CDS 100% 4.950 3.465 N Eif4enif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08641 pDONR223 100% 86.1% 87.6% None (many diffs) n/a
2 ccsbBroad304_08641 pLX_304 0% 86.1% 87.6% V5 (many diffs) n/a
3 ccsbBroadEn_08640 pDONR223 100% 71.8% 71.3% None (many diffs) n/a
4 ccsbBroad304_08640 pLX_304 0% 71.8% 71.3% V5 (many diffs) n/a
Download CSV