Transcript: Mouse XM_017314954.1

PREDICTED: Mus musculus dystrobrevin, beta (Dtnb), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dtnb (13528)
Length:
2293
CDS:
210..1946

Additional Resources:

NCBI RefSeq record:
XM_017314954.1
NBCI Gene record:
Dtnb (13528)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108762 GTCCATCTACTATCAGTTGAA pLKO.1 467 CDS 100% 4.950 6.930 N Dtnb n/a
2 TRCN0000108760 GCATGTACTAGCATCCGCATT pLKO.1 2199 3UTR 100% 4.050 5.670 N Dtnb n/a
3 TRCN0000263190 GATGAGGAACACCGGCTTATA pLKO_005 1404 CDS 100% 13.200 10.560 N Dtnb n/a
4 TRCN0000263191 TCCTCGCCCTCTGACCAATAT pLKO_005 1214 CDS 100% 13.200 10.560 N Dtnb n/a
5 TRCN0000282520 CATCAGTCTCCTACTCAATTT pLKO_005 530 CDS 100% 13.200 9.240 N Dtnb n/a
6 TRCN0000281582 CAGCTTGCAAGTTACGATTTG pLKO_005 319 CDS 100% 10.800 7.560 N Dtnb n/a
7 TRCN0000282522 GCACATTCCTGTCCGTCTTTC pLKO_005 2061 3UTR 100% 10.800 7.560 N Dtnb n/a
8 TRCN0000108761 GCCATGCAATTAGTAAATCTT pLKO.1 1108 CDS 100% 5.625 3.938 N Dtnb n/a
9 TRCN0000416464 CTGAGCCATGCAATTAGTAAA pLKO_005 1104 CDS 100% 13.200 7.920 N DTNB n/a
10 TRCN0000054200 GCAACCTTCATCTTGTTGATA pLKO.1 352 CDS 100% 5.625 3.375 N DTNB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314954.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00465 pDONR223 100% 83.9% 88.1% None (many diffs) n/a
2 ccsbBroad304_00465 pLX_304 0% 83.9% 88.1% V5 (many diffs) n/a
3 TRCN0000470172 TAGCTCTCCGCGAGATGAGTTAGG pLX_317 25.2% 83.9% 88.1% V5 (many diffs) n/a
Download CSV