Transcript: Mouse XM_017314987.1

PREDICTED: Mus musculus neurexin III (Nrxn3), transcript variant X41, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nrxn3 (18191)
Length:
7717
CDS:
1650..5192

Additional Resources:

NCBI RefSeq record:
XM_017314987.1
NBCI Gene record:
Nrxn3 (18191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094192 GCTCTATTATGATGGTTTGAA pLKO.1 4262 CDS 100% 5.625 7.875 N Nrxn3 n/a
2 TRCN0000094189 GCTCCAAGTGAGTCTGTAATA pLKO.1 5558 3UTR 100% 13.200 9.240 N Nrxn3 n/a
3 TRCN0000063569 GCTGCCTTAAAGAGGTTGTTT pLKO.1 1738 CDS 100% 5.625 3.938 N NRXN3 n/a
4 TRCN0000094193 CCATCTACAGAGCCTCATGTT pLKO.1 3029 CDS 100% 4.950 3.465 N Nrxn3 n/a
5 TRCN0000094190 CCACGTCAGATGATCTTGTTT pLKO.1 4483 CDS 100% 5.625 3.375 N Nrxn3 n/a
6 TRCN0000094191 CCCACGTCAGATGATCTTGTT pLKO.1 4482 CDS 100% 4.950 2.970 N Nrxn3 n/a
7 TRCN0000140179 GCACCTCTTCTTCCAGTTCAA pLKO.1 3209 CDS 100% 4.950 2.970 N NRXN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314987.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07403 pDONR223 100% 31.4% 30.1% None (many diffs) n/a
2 ccsbBroad304_07403 pLX_304 0% 31.4% 30.1% V5 (many diffs) n/a
3 TRCN0000470067 ATGCCACCTGACTCGACGTACTGA pLX_317 20.4% 31.4% 30.1% V5 (many diffs) n/a
Download CSV