Transcript: Mouse XM_017314998.1

PREDICTED: Mus musculus dicer 1, ribonuclease type III (Dicer1), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dicer1 (192119)
Length:
8750
CDS:
106..5409

Additional Resources:

NCBI RefSeq record:
XM_017314998.1
NBCI Gene record:
Dicer1 (192119)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017314998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304655 CCGCATGGTGGTGTCGATATT pLKO_005 3759 CDS 100% 13.200 18.480 N Dicer1 n/a
2 TRCN0000304657 TTGCGGTCCCTTACACTATAC pLKO_005 5807 3UTR 100% 10.800 15.120 N Dicer1 n/a
3 TRCN0000071320 CCGATGATGCAGCCTCTAATA pLKO.1 5146 CDS 100% 13.200 10.560 N Dicer1 n/a
4 TRCN0000304606 GAATTGCCTGATGGTACATTT pLKO_005 1627 CDS 100% 13.200 9.240 N Dicer1 n/a
5 TRCN0000071318 GCCTCACTTGACCTGAAGTAT pLKO.1 754 CDS 100% 5.625 3.938 N Dicer1 n/a
6 TRCN0000071322 CGAGCTGAAGAAGTCTGGTTT pLKO.1 2145 CDS 100% 4.950 3.465 N Dicer1 n/a
7 TRCN0000331536 CGAGCTGAAGAAGTCTGGTTT pLKO_005 2145 CDS 100% 4.950 3.465 N Dicer1 n/a
8 TRCN0000071321 GCTGGGATGATGGTAAGAGAA pLKO.1 622 CDS 100% 4.950 2.970 N Dicer1 n/a
9 TRCN0000302179 GCTGGGATGATGGTAAGAGAA pLKO_005 622 CDS 100% 4.950 2.970 N Dicer1 n/a
10 TRCN0000071319 CCTGCCATGATGAATGCTGTT pLKO.1 3442 CDS 100% 4.050 2.430 N Dicer1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017314998.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02759 pDONR223 100% 81.8% 85.6% None (many diffs) n/a
2 ccsbBroad304_02759 pLX_304 0% 81.8% 85.6% V5 (many diffs) n/a
3 TRCN0000491528 CTTAGGGCAATCCTTAGGTGAATG pLX_317 4.7% 81.8% 85.6% V5 (many diffs) n/a
Download CSV