Transcript: Mouse XM_017315019.1

PREDICTED: Mus musculus diacylglycerol kinase, beta (Dgkb), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dgkb (217480)
Length:
6282
CDS:
325..2733

Additional Resources:

NCBI RefSeq record:
XM_017315019.1
NBCI Gene record:
Dgkb (217480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362006 GACCCTTGAAGGACCATATTT pLKO_005 1403 CDS 100% 15.000 21.000 N Dgkb n/a
2 TRCN0000024931 CCTACCACAATCTGTCCAGTT pLKO.1 1429 CDS 100% 4.050 5.670 N Dgkb n/a
3 TRCN0000024932 CCCATTCTAGCCCAAATGTAA pLKO.1 599 CDS 100% 5.625 4.500 N Dgkb n/a
4 TRCN0000362001 GAAGCAAGGAGAACGAATTTA pLKO_005 1665 CDS 100% 15.000 10.500 N Dgkb n/a
5 TRCN0000362002 CAGACGTCATGCACCACTATT pLKO_005 1235 CDS 100% 13.200 9.240 N Dgkb n/a
6 TRCN0000024930 CCCTCCTGCATCAAGACATAT pLKO.1 1195 CDS 100% 13.200 9.240 N Dgkb n/a
7 TRCN0000024860 GCAATGGAAATGGGCCAAATT pLKO.1 2485 CDS 100% 13.200 9.240 N LOC382588 n/a
8 TRCN0000025549 GCTGCATGAATCTGTAGAAAT pLKO.1 2223 CDS 100% 13.200 9.240 N LOC382587 n/a
9 TRCN0000024929 CGAGTTTATGTTTCGCCTTTA pLKO.1 783 CDS 100% 10.800 7.560 N Dgkb n/a
10 TRCN0000024859 CCTCTGTGGTTATCAGAACAA pLKO.1 2549 CDS 100% 4.950 3.465 N LOC382588 n/a
11 TRCN0000024933 GCTACCTGTCTCTTCTCGAAA pLKO.1 740 CDS 100% 4.950 3.465 N Dgkb n/a
12 TRCN0000024863 GCTTGGAAGGAGCAATGGAAA pLKO.1 2474 CDS 100% 4.950 3.465 N LOC382588 n/a
13 TRCN0000024861 CCAAATTTACACGGGCCTGAA pLKO.1 2499 CDS 100% 4.050 2.835 N LOC382588 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 33 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14607 pDONR223 68.3% 88.1% 28.3% None (many diffs) n/a
2 ccsbBroad304_14607 pLX_304 0% 88.1% 28.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473795 GATAATAGTCGCCATTAGCGACGG pLX_317 16.3% 88.1% 28.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV