Transcript: Mouse XM_017315120.1

PREDICTED: Mus musculus pre-mRNA processing factor 39 (Prpf39), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Prpf39 (328110)
Length:
3043
CDS:
723..2363

Additional Resources:

NCBI RefSeq record:
XM_017315120.1
NBCI Gene record:
Prpf39 (328110)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295225 CGATTGCGAAGAGTAAGTTTA pLKO_005 1731 CDS 100% 13.200 18.480 N Prpf39 n/a
2 TRCN0000295296 AGGATGTAAACATAGTATATG pLKO_005 2420 3UTR 100% 13.200 10.560 N Prpf39 n/a
3 TRCN0000109177 GCTATCAAACTAGCCCGACAT pLKO.1 1842 CDS 100% 4.050 3.240 N Prpf39 n/a
4 TRCN0000287858 GCTATCAAACTAGCCCGACAT pLKO_005 1842 CDS 100% 4.050 3.240 N Prpf39 n/a
5 TRCN0000109176 GCCGAACATTTGCTTCAGGAT pLKO.1 1779 CDS 100% 2.640 2.112 N Prpf39 n/a
6 TRCN0000287788 GCCGAACATTTGCTTCAGGAT pLKO_005 1779 CDS 100% 2.640 2.112 N Prpf39 n/a
7 TRCN0000109179 ACATGGTTCATTGCCTATTAA pLKO.1 2030 CDS 100% 15.000 10.500 N Prpf39 n/a
8 TRCN0000287857 ACATGGTTCATTGCCTATTAA pLKO_005 2030 CDS 100% 15.000 10.500 N Prpf39 n/a
9 TRCN0000109178 CTTGGAATTATGGACAGTATT pLKO.1 2323 CDS 100% 13.200 9.240 N Prpf39 n/a
10 TRCN0000159678 GAAGGGAATTAGCTTCTGTAA pLKO.1 1165 CDS 100% 4.950 3.465 N PRPF39 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15880 pDONR223 0% 93.3% 96.3% None (many diffs) n/a
2 ccsbBroad304_15880 pLX_304 0% 93.3% 96.3% V5 (many diffs) n/a
3 TRCN0000467493 CCGCAGGGTTCTCTGACCCTCGGG pLX_317 23.6% 93.3% 96.3% V5 (many diffs) n/a
4 ccsbBroadEn_12136 pDONR223 100% 80% 80.1% None (many diffs) n/a
5 ccsbBroad304_12136 pLX_304 0% 80% 80.1% V5 (many diffs) n/a
6 TRCN0000468371 ACCTGGAGGATGCGCACCAAGTCA pLX_317 18.7% 80% 80.1% V5 (many diffs) n/a
Download CSV