Transcript: Mouse XM_017315922.1

PREDICTED: Mus musculus protein phosphatase 3, catalytic subunit, gamma isoform (Ppp3cc), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp3cc (19057)
Length:
2366
CDS:
464..1657

Additional Resources:

NCBI RefSeq record:
XM_017315922.1
NBCI Gene record:
Ppp3cc (19057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006876 GCCCTCTTAAACCAGCAGTTT pLKO.1 1016 CDS 100% 4.950 3.960 N PPP3CC n/a
2 TRCN0000012695 GCTGTATCTATGGAGCTTAAA pLKO.1 841 CDS 100% 13.200 9.240 N Ppp3cc n/a
3 TRCN0000012696 CGGATGAAGAAATGAACGTAA pLKO.1 1569 CDS 100% 4.950 3.465 N Ppp3cc n/a
4 TRCN0000012694 CGGCTAACTTTGAAGGAAGTT pLKO.1 536 CDS 100% 0.495 0.347 N Ppp3cc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315922.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06761 pDONR223 100% 67.9% 68.2% None (many diffs) n/a
2 ccsbBroad304_06761 pLX_304 0% 67.9% 68.2% V5 (many diffs) n/a
3 TRCN0000475207 ACGACCATGATACGACGGACCGAT pLX_317 21.2% 67.9% 68.2% V5 (many diffs) n/a
Download CSV