Transcript: Mouse XM_017315949.1

PREDICTED: Mus musculus PX domain containing serine/threonine kinase (Pxk), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pxk (218699)
Length:
1862
CDS:
124..1764

Additional Resources:

NCBI RefSeq record:
XM_017315949.1
NBCI Gene record:
Pxk (218699)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001487114 TCTTCCGATCAGAACCAAAG pXPR_003 TGG 432 26% 5 0.2156 Pxk PXK 78019
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363368 GCAGTCGCACACGGAATATAT pLKO_005 213 CDS 100% 15.000 21.000 N Pxk n/a
2 TRCN0000026966 CCGATCCTACTTCACACAATT pLKO.1 1074 CDS 100% 13.200 18.480 N Pxk n/a
3 TRCN0000026967 CCCAAACAACTATTCTGCAAA pLKO.1 483 CDS 100% 4.950 3.465 N Pxk n/a
4 TRCN0000026987 CGGCAGATATTAGAGGCACTA pLKO.1 931 CDS 100% 4.050 2.835 N Pxk n/a
5 TRCN0000001801 GTCTAATCAAACTTCTGCCTT pLKO.1 710 CDS 100% 2.640 1.848 N PXK n/a
6 TRCN0000342361 GTCTAATCAAACTTCTGCCTT pLKO_005 710 CDS 100% 2.640 1.848 N PXK n/a
7 TRCN0000195613 CGGCTCTTACAGATGCCATTA pLKO.1 1288 CDS 100% 10.800 6.480 N PXK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12106 pDONR223 100% 73.2% 78.7% None (many diffs) n/a
2 ccsbBroad304_12106 pLX_304 0% 73.2% 78.7% V5 (many diffs) n/a
3 TRCN0000471464 CGATAACATCTCGACTATGCAATA pLX_317 35.6% 73.2% 78.7% V5 (many diffs) n/a
4 ccsbBroadEn_15084 pDONR223 0% 73.2% 78.7% None (many diffs) n/a
5 ccsbBroad304_15084 pLX_304 0% 73.2% 78.7% V5 (many diffs) n/a
6 TRCN0000465367 CCCCCTCCTCTAAACAATTGGTAC pLX_317 14.5% 73.2% 78.7% V5 (many diffs) n/a
Download CSV