Transcript: Mouse XM_017316523.1

PREDICTED: Mus musculus trans-acting transcription factor 1 (Sp1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sp1 (20683)
Length:
7842
CDS:
157..2481

Additional Resources:

NCBI RefSeq record:
XM_017316523.1
NBCI Gene record:
Sp1 (20683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226182 CCCTGGAGTAATGCCTAATAT pLKO_005 624 CDS 100% 15.000 21.000 N Sp1 n/a
2 TRCN0000226185 TATGGGATGAAGGTGTTATAA pLKO_005 5992 3UTR 100% 15.000 21.000 N Sp1 n/a
3 TRCN0000071607 CCAATGCCAATAGTTATTCAA pLKO.1 1097 CDS 100% 5.625 7.875 N Sp1 n/a
4 TRCN0000218003 CTTCACAACTCAAGCTATTTC pLKO_005 1404 CDS 100% 13.200 10.560 N Sp1 n/a
5 TRCN0000360660 AGAGAGCCATGAGGCATTAAT pLKO_005 2570 3UTR 100% 15.000 10.500 N Sp1 n/a
6 TRCN0000360587 AGCCATCATGCCTTGATAAAT pLKO_005 2827 3UTR 100% 15.000 10.500 N Sp1 n/a
7 TRCN0000020446 CCACTCCTTCAGCCCTTATTA pLKO.1 2336 CDS 100% 15.000 10.500 N SP1 n/a
8 TRCN0000360591 ACCAACAGATCATCCCAAATA pLKO_005 764 CDS 100% 13.200 9.240 N Sp1 n/a
9 TRCN0000360589 ACGAGCTTCAGAGACATAAAC pLKO_005 2141 CDS 100% 13.200 9.240 N Sp1 n/a
10 TRCN0000226184 CACTCCTTCAGCCCTTATTAC pLKO_005 2337 CDS 100% 13.200 9.240 N Sp1 n/a
11 TRCN0000071606 CCTTCACAACTCAAGCTATTT pLKO.1 1403 CDS 100% 13.200 9.240 N Sp1 n/a
12 TRCN0000071605 GCAGGATGGTTCTGGTCAAAT pLKO.1 723 CDS 100% 13.200 9.240 N Sp1 n/a
13 TRCN0000226183 TCATGTGTAATTGGTCATATT pLKO_005 2096 CDS 100% 13.200 9.240 N Sp1 n/a
14 TRCN0000360661 CCATCTGTCCAGAGGGTATTG pLKO_005 2381 CDS 100% 10.800 7.560 N Sp1 n/a
15 TRCN0000071603 GCAGCAGTAATACCACCCTAA pLKO.1 1619 CDS 100% 4.050 2.835 N Sp1 n/a
16 TRCN0000071604 CCCAACTTACAGAACCAGCAA pLKO.1 589 CDS 100% 2.640 1.848 N Sp1 n/a
17 TRCN0000020447 CCAGGTGCAAACCAACAGATT pLKO.1 754 CDS 100% 4.950 3.465 N SP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316523.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489380 AGAGTAATAAGTTCTAAGTCATCT pLX_317 8.5% 90.6% 93.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV