Transcript: Mouse XM_017316527.1

PREDICTED: Mus musculus PHD finger protein 21A (Phf21a), transcript variant X19, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf21a (192285)
Length:
8539
CDS:
2230..4296

Additional Resources:

NCBI RefSeq record:
XM_017316527.1
NBCI Gene record:
Phf21a (192285)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340699 CCCGAGTTTGCCAATTGATTC pLKO_005 4437 3UTR 100% 10.800 15.120 N Phf21a n/a
2 TRCN0000340619 GAGTGCAGTCACTTACCTTAA pLKO_005 3489 CDS 100% 10.800 15.120 N Phf21a n/a
3 TRCN0000037001 CCAGAGACCTACCATTGCTAT pLKO.1 2706 CDS 100% 4.950 6.930 N PHF21A n/a
4 TRCN0000327709 CCAGAGACCTACCATTGCTAT pLKO_005 2706 CDS 100% 4.950 6.930 N PHF21A n/a
5 TRCN0000124328 GCGCAAGAACCTGATAGTCAA pLKO.1 2403 CDS 100% 4.950 6.930 N Phf21a n/a
6 TRCN0000124326 GCCCATCAAAGTACCACAGTT pLKO.1 2889 CDS 100% 4.950 3.960 N Phf21a n/a
7 TRCN0000340623 TAAGTGGAGTTCAGATTTAAA pLKO_005 3966 CDS 100% 15.000 10.500 N Phf21a n/a
8 TRCN0000340700 AGAGCTCAGCAGTTCTATAAG pLKO_005 4020 CDS 100% 13.200 9.240 N Phf21a n/a
9 TRCN0000340698 ATTCCTACATCGCCTACAAAG pLKO_005 3914 CDS 100% 10.800 7.560 N Phf21a n/a
10 TRCN0000124327 CATTCCTACATCGCCTACAAA pLKO.1 3913 CDS 100% 5.625 3.938 N Phf21a n/a
11 TRCN0000124324 CCGGATTTCTTCTGGAAAGTA pLKO.1 4358 3UTR 100% 5.625 3.938 N Phf21a n/a
12 TRCN0000037000 CCCATCAAAGTACCACAGTTT pLKO.1 2890 CDS 100% 4.950 3.465 N PHF21A n/a
13 TRCN0000327785 CCCATCAAAGTACCACAGTTT pLKO_005 2890 CDS 100% 4.950 3.465 N PHF21A n/a
14 TRCN0000124325 GCCTGGAGAAACAGACAGTTA pLKO.1 3236 CDS 100% 4.950 2.970 N Phf21a n/a
15 TRCN0000036999 GCCCAGAATAACATTCCTATT pLKO.1 2974 CDS 100% 10.800 8.640 N PHF21A n/a
16 TRCN0000327712 GCCCAGAATAACATTCCTATT pLKO_005 2974 CDS 100% 10.800 8.640 N PHF21A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316527.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03282 pDONR223 100% 91.6% 94.3% None (many diffs) n/a
2 ccsbBroad304_03282 pLX_304 0% 91.6% 94.3% V5 (many diffs) n/a
3 TRCN0000479630 TCAAGGCTACCTTCCTCGCATTGT pLX_317 18.5% 91.6% 94.3% V5 (many diffs) n/a
Download CSV