Transcript: Mouse XM_017316535.1

PREDICTED: Mus musculus PHD finger protein 21A (Phf21a), transcript variant X29, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phf21a (192285)
Length:
2473
CDS:
266..2191

Additional Resources:

NCBI RefSeq record:
XM_017316535.1
NBCI Gene record:
Phf21a (192285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000340699 CCCGAGTTTGCCAATTGATTC pLKO_005 2332 3UTR 100% 10.800 15.120 N Phf21a n/a
2 TRCN0000340619 GAGTGCAGTCACTTACCTTAA pLKO_005 1525 CDS 100% 10.800 15.120 N Phf21a n/a
3 TRCN0000037001 CCAGAGACCTACCATTGCTAT pLKO.1 742 CDS 100% 4.950 6.930 N PHF21A n/a
4 TRCN0000327709 CCAGAGACCTACCATTGCTAT pLKO_005 742 CDS 100% 4.950 6.930 N PHF21A n/a
5 TRCN0000124328 GCGCAAGAACCTGATAGTCAA pLKO.1 439 CDS 100% 4.950 6.930 N Phf21a n/a
6 TRCN0000124326 GCCCATCAAAGTACCACAGTT pLKO.1 925 CDS 100% 4.950 3.960 N Phf21a n/a
7 TRCN0000340623 TAAGTGGAGTTCAGATTTAAA pLKO_005 1861 CDS 100% 15.000 10.500 N Phf21a n/a
8 TRCN0000340700 AGAGCTCAGCAGTTCTATAAG pLKO_005 1915 CDS 100% 13.200 9.240 N Phf21a n/a
9 TRCN0000340698 ATTCCTACATCGCCTACAAAG pLKO_005 1809 CDS 100% 10.800 7.560 N Phf21a n/a
10 TRCN0000124327 CATTCCTACATCGCCTACAAA pLKO.1 1808 CDS 100% 5.625 3.938 N Phf21a n/a
11 TRCN0000124324 CCGGATTTCTTCTGGAAAGTA pLKO.1 2253 3UTR 100% 5.625 3.938 N Phf21a n/a
12 TRCN0000037000 CCCATCAAAGTACCACAGTTT pLKO.1 926 CDS 100% 4.950 3.465 N PHF21A n/a
13 TRCN0000327785 CCCATCAAAGTACCACAGTTT pLKO_005 926 CDS 100% 4.950 3.465 N PHF21A n/a
14 TRCN0000124325 GCCTGGAGAAACAGACAGTTA pLKO.1 1272 CDS 100% 4.950 2.970 N Phf21a n/a
15 TRCN0000036999 GCCCAGAATAACATTCCTATT pLKO.1 1010 CDS 100% 10.800 8.640 N PHF21A n/a
16 TRCN0000327712 GCCCAGAATAACATTCCTATT pLKO_005 1010 CDS 100% 10.800 8.640 N PHF21A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316535.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03282 pDONR223 100% 84.8% 86.4% None (many diffs) n/a
2 ccsbBroad304_03282 pLX_304 0% 84.8% 86.4% V5 (many diffs) n/a
3 TRCN0000479630 TCAAGGCTACCTTCCTCGCATTGT pLX_317 18.5% 84.8% 86.4% V5 (many diffs) n/a
Download CSV