Transcript: Mouse XM_017316745.1

PREDICTED: Mus musculus Nipped-B homolog (Drosophila) (Nipbl), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nipbl (71175)
Length:
9983
CDS:
668..9064

Additional Resources:

NCBI RefSeq record:
XM_017316745.1
NBCI Gene record:
Nipbl (71175)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000124034 CGCGCCTTTCTTATTTCTTTA pLKO.1 7868 CDS 100% 13.200 18.480 N Nipbl n/a
2 TRCN0000313515 GGACGTAAACCGCCCACTTAA pLKO_005 1891 CDS 100% 13.200 18.480 N Nipbl n/a
3 TRCN0000124035 GCGTGCTTGATTGTTCGATAT pLKO.1 5906 CDS 100% 10.800 15.120 N Nipbl n/a
4 TRCN0000317135 GCGTGCTTGATTGTTCGATAT pLKO_005 5906 CDS 100% 10.800 15.120 N Nipbl n/a
5 TRCN0000124036 CGCTTCTCAAAGGAAGTTCAA pLKO.1 2135 CDS 100% 4.950 6.930 N Nipbl n/a
6 TRCN0000313516 GATTGTGGAGAGACCTAATTA pLKO_005 4530 CDS 100% 15.000 10.500 N Nipbl n/a
7 TRCN0000148381 CTCAGGATTCAGACTCCATAA pLKO.1 2340 CDS 100% 10.800 7.560 N NIPBL n/a
8 TRCN0000124037 GCCTGTTTCAATAGATACTAT pLKO.1 6971 CDS 100% 5.625 3.938 N Nipbl n/a
9 TRCN0000317072 GCCTGTTTCAATAGATACTAT pLKO_005 6971 CDS 100% 5.625 3.938 N Nipbl n/a
10 TRCN0000124038 CCTCCTCTTTAATTCACGAAT pLKO.1 784 CDS 100% 4.950 3.465 N Nipbl n/a
11 TRCN0000317071 CCTCCTCTTTAATTCACGAAT pLKO_005 784 CDS 100% 4.950 3.465 N Nipbl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15773 pDONR223 0% 5.5% 5.7% None (many diffs) n/a
2 ccsbBroad304_15773 pLX_304 0% 5.5% 5.7% V5 (many diffs) n/a
3 TRCN0000478612 TTCTAGCTCAGTTGTAAAGACCCC pLX_317 66% 5.5% 5.7% V5 (many diffs) n/a
Download CSV