Transcript: Mouse XM_017316914.1

PREDICTED: Mus musculus ArfGAP with FG repeats 1 (Agfg1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agfg1 (15463)
Length:
7809
CDS:
259..1866

Additional Resources:

NCBI RefSeq record:
XM_017316914.1
NBCI Gene record:
Agfg1 (15463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017316914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313153 GCCTCGGTTCATGCGTCTATT pLKO_005 667 CDS 100% 13.200 18.480 N Agfg1 n/a
2 TRCN0000110793 CGCCACGTTTGGACAAACAAA pLKO.1 1725 CDS 100% 5.625 7.875 N Agfg1 n/a
3 TRCN0000312177 CGCCACGTTTGGACAAACAAA pLKO_005 1725 CDS 100% 5.625 7.875 N Agfg1 n/a
4 TRCN0000110790 GCCTTTACCAAAGTGGCCTTA pLKO.1 2511 3UTR 100% 4.050 5.670 N Agfg1 n/a
5 TRCN0000313227 GTACCGGAACGAACGTTTATG pLKO_005 1882 3UTR 100% 0.000 0.000 N Agfg1 n/a
6 TRCN0000313226 ACAGATATGGCTAGGATTATT pLKO_005 528 CDS 100% 15.000 12.000 N Agfg1 n/a
7 TRCN0000110791 CCTCGGTTCATGCGTCTATTT pLKO.1 668 CDS 100% 13.200 10.560 N Agfg1 n/a
8 TRCN0000110792 GCAGACAAATATGCGGCACTT pLKO.1 1108 CDS 100% 4.050 2.835 N Agfg1 n/a
9 TRCN0000110794 GCAAACAGATATGGCTAGGAT pLKO.1 524 CDS 100% 3.000 2.100 N Agfg1 n/a
10 TRCN0000060227 CCACCTCCAGTAATGCGTATA pLKO.1 1301 CDS 100% 10.800 6.480 N AGFG1 n/a
11 TRCN0000333060 CCACCTCCAGTAATGCGTATA pLKO_005 1301 CDS 100% 10.800 6.480 N AGFG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017316914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15453 pDONR223 0% 82.9% 87% None (many diffs) n/a
2 ccsbBroad304_15453 pLX_304 0% 82.9% 87% V5 (many diffs) n/a
3 TRCN0000480322 AAACGCCAACCAAGTTGCGGTACA pLX_317 23.7% 82.9% 87% V5 (many diffs) n/a
4 ccsbBroadEn_14670 pDONR223 95.3% 82.9% 86.8% None (many diffs) n/a
5 ccsbBroad304_14670 pLX_304 0% 82.9% 86.8% V5 (many diffs) n/a
6 TRCN0000468166 TACGCAAAGCTATAGTTCATCTCT pLX_317 21.7% 82.9% 86.8% V5 (many diffs) n/a
Download CSV