Transcript: Mouse XM_017317105.1

PREDICTED: Mus musculus zinc finger and BTB domain containing 20 (Zbtb20), transcript variant X46, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zbtb20 (56490)
Length:
26514
CDS:
662..2668

Additional Resources:

NCBI RefSeq record:
XM_017317105.1
NBCI Gene record:
Zbtb20 (56490)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000086328 GCCTGCTGGTACATTACATTT pLKO.1 2847 3UTR 100% 13.200 18.480 N Zbtb20 n/a
2 TRCN0000312807 GGGCTACAGCGACATCGAAAT pLKO_005 847 CDS 100% 10.800 15.120 N Zbtb20 n/a
3 TRCN0000086330 CGGGTCATCTGATTGTGACAT pLKO.1 628 5UTR 100% 4.950 6.930 N Zbtb20 n/a
4 TRCN0000086329 GCCCAGCAAAGTTTGACCAAA pLKO.1 2601 CDS 100% 4.950 3.960 N Zbtb20 n/a
5 TRCN0000312851 AGCTATGGCACTAGAATTTAA pLKO_005 2746 3UTR 100% 15.000 10.500 N Zbtb20 n/a
6 TRCN0000222178 CCCAGCAAAGTTTGACCAAAT pLKO.1 2602 CDS 100% 10.800 7.560 N ZBTB20 n/a
7 TRCN0000312848 TGTCAGTAACAGCTCCGATAA pLKO_005 1783 CDS 100% 10.800 7.560 N Zbtb20 n/a
8 TRCN0000086331 GCCTTCAGTCAACACATCCAT pLKO.1 1819 CDS 100% 3.000 2.100 N Zbtb20 n/a
9 TRCN0000311870 GCCTTCAGTCAACACATCCAT pLKO_005 1819 CDS 100% 3.000 2.100 N Zbtb20 n/a
10 TRCN0000086332 CAGATCCTAGAACGCAATGAA pLKO.1 1478 CDS 100% 5.625 3.375 N Zbtb20 n/a
11 TRCN0000311807 CAGATCCTAGAACGCAATGAA pLKO_005 1478 CDS 100% 5.625 3.375 N Zbtb20 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 23257 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000178741 CACACACATACACACACACAA pLKO.1 3063 3UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317105.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07993 pDONR223 100% 92.2% 97.6% None (many diffs) n/a
2 ccsbBroad304_07993 pLX_304 0% 92.2% 97.6% V5 (many diffs) n/a
3 TRCN0000476850 ACTACCACCCCAGAAATTGACATC pLX_317 19% 92.2% 97.6% V5 (many diffs) n/a
Download CSV