Transcript: Mouse XM_017317142.1

PREDICTED: Mus musculus glyoxylate reductase 1 homolog (Arabidopsis) (Glyr1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Glyr1 (74022)
Length:
3697
CDS:
643..2076

Additional Resources:

NCBI RefSeq record:
XM_017317142.1
NBCI Gene record:
Glyr1 (74022)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241373 ATGACAAGAATCGGCGTAATT pLKO_005 752 CDS 100% 13.200 18.480 N Glyr1 n/a
2 TRCN0000191376 CGGTTAGTCAATGTTGTCTTA pLKO.1 3352 3UTR 100% 4.950 6.930 N Glyr1 n/a
3 TRCN0000241374 TGGACCGATGGCTGCATTTAA pLKO_005 1014 CDS 100% 15.000 12.000 N Glyr1 n/a
4 TRCN0000241372 AGCCTGATCAACACCAATAAT pLKO_005 2963 3UTR 100% 15.000 10.500 N Glyr1 n/a
5 TRCN0000241376 AGAGGCTCCAAATGCCTTAAA pLKO_005 895 CDS 100% 13.200 9.240 N Glyr1 n/a
6 TRCN0000217884 GGACCAGTCTGACAATGATAT pLKO.1 2025 CDS 100% 13.200 9.240 N Glyr1 n/a
7 TRCN0000241375 TAAAGATTAACAAGGGTAAAC pLKO_005 647 CDS 100% 10.800 7.560 N Glyr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317142.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12837 pDONR223 100% 91.3% 97.1% None (many diffs) n/a
2 ccsbBroad304_12837 pLX_304 0% 91.3% 97.1% V5 (many diffs) n/a
3 TRCN0000478521 CACCAGGACAGGTCCAATTAGTTT pLX_317 26.5% 91.3% 97.1% V5 (many diffs) n/a
Download CSV