Transcript: Mouse XM_017317155.1

PREDICTED: Mus musculus N(alpha)-acetyltransferase 60, NatF catalytic subunit (Naa60), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Naa60 (74763)
Length:
2359
CDS:
190..591

Additional Resources:

NCBI RefSeq record:
XM_017317155.1
NBCI Gene record:
Naa60 (74763)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114645 AGACTCATGGTATCGTGATAT pLKO.1 306 CDS 100% 13.200 18.480 N Naa60 n/a
2 TRCN0000317646 AGACTCATGGTATCGTGATAT pLKO_005 306 CDS 100% 13.200 18.480 N Naa60 n/a
3 TRCN0000114642 CGACTGGTTTCCCATTGAGTA pLKO.1 282 CDS 100% 4.950 6.930 N Naa60 n/a
4 TRCN0000163819 CCAGACTCATGGTATCGTGAT pLKO.1 304 CDS 100% 4.050 5.670 N NAA60 n/a
5 TRCN0000114641 GCGTTCTTACTCCTCCATGAA pLKO.1 1320 3UTR 100% 4.950 3.960 N Naa60 n/a
6 TRCN0000317730 GCGTTCTTACTCCTCCATGAA pLKO_005 1320 3UTR 100% 4.950 3.960 N Naa60 n/a
7 TRCN0000350019 GGGAATGATAGTAGCTGAAAT pLKO_005 381 CDS 100% 13.200 9.240 N Naa60 n/a
8 TRCN0000425678 GTGCCATTGTGGGAATGATAG pLKO_005 371 CDS 100% 10.800 7.560 N NAA60 n/a
9 TRCN0000162306 CAGACTCATGGTATCGTGATA pLKO.1 305 CDS 100% 4.950 3.465 N NAA60 n/a
10 TRCN0000162627 CGATGACATAGACACTGTGAA pLKO.1 249 CDS 100% 4.950 3.465 N NAA60 n/a
11 TRCN0000114643 GCATCACTATCTGCCCTACTA pLKO.1 610 3UTR 100% 4.950 3.465 N Naa60 n/a
12 TRCN0000317648 GCATCACTATCTGCCCTACTA pLKO_005 610 3UTR 100% 4.950 3.465 N Naa60 n/a
13 TRCN0000164060 CCTCAAAGATGGCTTCACCTA pLKO.1 649 3UTR 100% 2.640 1.848 N NAA60 n/a
14 TRCN0000114644 GTGGTGAAAGAGTTCAGGAAA pLKO.1 496 CDS 100% 4.950 2.970 N Naa60 n/a
15 TRCN0000317728 GTGGTGAAAGAGTTCAGGAAA pLKO_005 496 CDS 100% 4.950 2.970 N Naa60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317155.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08982 pDONR223 100% 52% 48.7% None (many diffs) n/a
2 ccsbBroad304_08982 pLX_304 0% 52% 48.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473974 TACGTAGTTCTACTATCGCCCGTT pLX_317 80.5% 52% 48.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV