Transcript: Mouse XM_017317244.1

PREDICTED: Mus musculus fer (fms/fps related) protein kinase (Fer), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Fer (14158)
Length:
8899
CDS:
93..1397

Additional Resources:

NCBI RefSeq record:
XM_017317244.1
NBCI Gene record:
Fer (14158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361140 TCATACAATTTGTCGATAATC pLKO_005 445 CDS 100% 13.200 18.480 N Fer n/a
2 TRCN0000361196 GTCCTACCCAGAGCCGTATTA pLKO_005 1566 3UTR 100% 13.200 10.560 N Fer n/a
3 TRCN0000361131 ATTCAATTGCTGGGATAATTA pLKO_005 202 CDS 100% 15.000 10.500 N Fer n/a
4 TRCN0000023639 CGGACAAAGGAGGCACTTTAT pLKO.1 425 CDS 100% 13.200 9.240 N Fer n/a
5 TRCN0000023640 CCCAATATTGTCAAACTGATA pLKO.1 780 CDS 100% 4.950 3.465 N Fer n/a
6 TRCN0000023641 GCTATCCAAATTTGAGTCTAT pLKO.1 176 CDS 100% 4.950 3.465 N Fer n/a
7 TRCN0000023642 GCTCACTGTCATCAAGAAGAT pLKO.1 1367 CDS 100% 4.950 3.465 N Fer n/a
8 TRCN0000023643 GCTGAAGCAGTTGGTGAGATT pLKO.1 899 CDS 100% 4.950 3.465 N Fer n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317244.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14636 pDONR223 0% 45.2% 44.8% None (many diffs) n/a
2 ccsbBroad304_14636 pLX_304 0% 45.2% 44.8% V5 (many diffs) n/a
3 TRCN0000481126 AGGCTGTACATTGACAACTCCGAA pLX_317 17% 45.1% 44.7% V5 (many diffs) n/a
4 TRCN0000489132 AGAAAATTTGATATAATTGCCAAT pLX_317 13.3% 45.2% 44.8% V5 (many diffs) n/a
Download CSV