Transcript: Mouse XM_017317326.1

PREDICTED: Mus musculus 3-phosphoinositide dependent protein kinase 1 (Pdpk1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pdpk1 (18607)
Length:
6883
CDS:
82..1680

Additional Resources:

NCBI RefSeq record:
XM_017317326.1
NBCI Gene record:
Pdpk1 (18607)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145239 TCTGCTTTAGAGTACTTGCA pXPR_003 TGG 515 32% 5 0.3875 Pdpk1 PDPK1 77452
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022734 GCCGGGAATGAATATCTTATA pLKO.1 859 CDS 100% 13.200 18.480 N Pdpk1 n/a
2 TRCN0000280554 GCCGGGAATGAATATCTTATA pLKO_005 859 CDS 100% 13.200 18.480 N Pdpk1 n/a
3 TRCN0000022738 CGACAGTTATTACTCACAGAA pLKO.1 1429 CDS 100% 4.950 3.960 N Pdpk1 n/a
4 TRCN0000361331 TTCTGGAGAAACGTCATATTA pLKO_005 344 CDS 100% 15.000 10.500 N Pdpk1 n/a
5 TRCN0000022736 GCTGAGATTGTGTCTGCTTTA pLKO.1 568 CDS 100% 10.800 7.560 N Pdpk1 n/a
6 TRCN0000022735 CCTGTCAACAAGGTCTTGAAA pLKO.1 1474 CDS 100% 5.625 3.938 N Pdpk1 n/a
7 TRCN0000280555 CCTGTCAACAAGGTCTTGAAA pLKO_005 1474 CDS 100% 5.625 3.938 N Pdpk1 n/a
8 TRCN0000221540 CCTTGGCACCAGTTTGTAGAA pLKO.1 1348 CDS 100% 4.950 3.465 N PDPK1 n/a
9 TRCN0000001476 GCAGCAACATAGAGCAGTACA pLKO.1 1235 CDS 100% 4.950 3.465 N PDPK1 n/a
10 TRCN0000022737 GCTCATTTGATGAGACCTGTA pLKO.1 533 CDS 100% 4.050 2.835 N Pdpk1 n/a
11 TRCN0000280494 GCTCATTTGATGAGACCTGTA pLKO_005 533 CDS 100% 4.050 2.835 N Pdpk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317326.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487873 CCTTACGAGACCCGGGACGTAGGT pLX_317 17.3% 83.2% 89.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487875 ACAAACAGTCCTGGGTGGCTTGGC pLX_317 19.2% 83.2% 89.6% V5 (many diffs) n/a
3 ccsbBroadEn_01168 pDONR223 100% 62.4% 66.9% None (many diffs) n/a
4 ccsbBroad304_01168 pLX_304 31.2% 62.2% 66.3% V5 (many diffs) n/a
5 ccsbBroadEn_14741 pDONR223 0% 62.4% 66.9% None (many diffs) n/a
6 ccsbBroad304_14741 pLX_304 41.3% 62.4% 66.9% V5 (many diffs) n/a
7 TRCN0000480980 CAGTAGTGACAATACTGCTATGTA pLX_317 36% 62.4% 66.9% V5 (many diffs) n/a
Download CSV