Transcript: Mouse XM_017317365.1

PREDICTED: Mus musculus special AT-rich sequence binding protein 1 (Satb1), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Satb1 (20230)
Length:
6145
CDS:
2613..4904

Additional Resources:

NCBI RefSeq record:
XM_017317365.1
NBCI Gene record:
Satb1 (20230)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039093 CGTTGCTGTCTCTAGGCTATT pLKO.1 2953 CDS 100% 10.800 15.120 N Satb1 n/a
2 TRCN0000413050 GAAGGGAGCACAGACGTTAAT pLKO_005 4866 CDS 100% 13.200 10.560 N Satb1 n/a
3 TRCN0000412817 AGGTGCCAACCACGTCAATTT pLKO_005 3398 CDS 100% 13.200 9.240 N Satb1 n/a
4 TRCN0000430865 TTGTGAACAGCACGTACTATG pLKO_005 3268 CDS 100% 10.800 7.560 N Satb1 n/a
5 TRCN0000039092 CCCTGTCAGTAGGTCTATGAA pLKO.1 3665 CDS 100% 5.625 3.938 N Satb1 n/a
6 TRCN0000039091 CCTGTCGATGATCCGAAGATT pLKO.1 4256 CDS 100% 5.625 3.938 N Satb1 n/a
7 TRCN0000039090 CCCGAAGTACACCATCATCAA pLKO.1 4664 CDS 100% 4.950 3.465 N Satb1 n/a
8 TRCN0000039089 GCTTTCTGAAATCCTCCGAAA pLKO.1 3824 CDS 100% 4.050 2.835 N Satb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01484 pDONR223 100% 91.2% 98.2% None (many diffs) n/a
2 ccsbBroad304_01484 pLX_304 0% 91.2% 98.2% V5 (many diffs) n/a
3 TRCN0000474374 AAACCATCTCCGACATGAATGTTA pLX_317 24.6% 91.2% 98.2% V5 (many diffs) n/a
Download CSV