Transcript: Mouse XM_017317973.1

PREDICTED: Mus musculus polyadenylate-binding protein-interacting protein 2 (Paip2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Paip2 (67869)
Length:
1608
CDS:
336..710

Additional Resources:

NCBI RefSeq record:
XM_017317973.1
NBCI Gene record:
Paip2 (67869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000249291 GAATTTATTGAACGCTGTTTC pLKO_005 498 CDS 100% 10.800 8.640 N Paip2 n/a
2 TRCN0000434340 GAATTTATTGAACGCTGTTTC pLKO_005 498 CDS 100% 10.800 8.640 N PAIP2 n/a
3 TRCN0000152692 GATCTTGTGGTCAAGAGCAAT pLKO.1 645 CDS 100% 0.495 0.396 N PAIP2 n/a
4 TRCN0000249292 GTTAGTCTTGCATGCTTAATA pLKO_005 837 3UTR 100% 15.000 10.500 N Paip2 n/a
5 TRCN0000418026 GTTAGTCTTGCATGCTTAATA pLKO_005 837 3UTR 100% 15.000 10.500 N PAIP2 n/a
6 TRCN0000249293 CATGAAGAGGATAATCCATTT pLKO_005 408 CDS 100% 10.800 7.560 N Paip2 n/a
7 TRCN0000219945 TGTGATTATTAACGGTCATTC pLKO.1 386 CDS 100% 10.800 7.560 N PAIP2 n/a
8 TRCN0000249294 TGTGATTATTAACGGTCATTC pLKO_005 386 CDS 100% 10.800 7.560 N Paip2 n/a
9 TRCN0000150678 GACCAGTTTAATGACCTTGTT pLKO.1 600 CDS 100% 4.950 3.465 N PAIP2 n/a
10 TRCN0000152014 CAGACAAATAGAAGAGGAGTT pLKO.1 467 CDS 100% 4.050 2.835 N PAIP2 n/a
11 TRCN0000257872 ACCAAATCCAAGACCAGTTTA pLKO_005 589 CDS 100% 13.200 7.920 N Paip2 n/a
12 TRCN0000434167 ACGGTCATTCTCATGAAGATG pLKO_005 397 CDS 100% 4.950 3.465 N PAIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317973.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03253 pDONR223 100% 95.8% 96% None (many diffs) n/a
2 ccsbBroad304_03253 pLX_304 0% 95.8% 96% V5 (many diffs) n/a
3 TRCN0000478712 GCTTTATTCTGTTAGGATTAGCGC pLX_317 100% 95.8% 96% V5 (many diffs) n/a
Download CSV