Transcript: Mouse XM_017317989.1

PREDICTED: Mus musculus Rho GTPase activating protein 26 (Arhgap26), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Arhgap26 (71302)
Length:
7574
CDS:
289..2451

Additional Resources:

NCBI RefSeq record:
XM_017317989.1
NBCI Gene record:
Arhgap26 (71302)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017317989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000094891 CGGAGTCGAATGATCGAGAAT pLKO.1 583 CDS 100% 4.950 6.930 N Arhgap26 n/a
2 TRCN0000094890 CGGCAACATTTCTACGAAGTA pLKO.1 793 CDS 100% 4.950 6.930 N Arhgap26 n/a
3 TRCN0000424983 GCGAGATCTTTGCAAGAATTT pLKO_005 532 CDS 100% 13.200 9.240 N Arhgap26 n/a
4 TRCN0000416229 AGGATGAGAATAGTGCTAAAG pLKO_005 2799 3UTR 100% 10.800 7.560 N Arhgap26 n/a
5 TRCN0000094893 CCAGTTTCAAAGAAGTTTCAT pLKO.1 1683 CDS 100% 5.625 3.938 N Arhgap26 n/a
6 TRCN0000094892 CCCAGAGAACTACGTGGAATT pLKO.1 2424 CDS 100% 0.000 0.000 N Arhgap26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017317989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07836 pDONR223 100% 81.1% 85.8% None (many diffs) n/a
2 ccsbBroad304_07836 pLX_304 0% 81.1% 85.8% V5 (many diffs) n/a
3 TRCN0000469771 TCTGGCCGAGTACCGTGCCCTATT pLX_317 18.1% 81.1% 85.8% V5 (many diffs) n/a
Download CSV