Transcript: Mouse XM_017318187.1

PREDICTED: Mus musculus splicing factor 1 (Sf1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sf1 (22668)
Length:
2002
CDS:
249..1817

Additional Resources:

NCBI RefSeq record:
XM_017318187.1
NBCI Gene record:
Sf1 (22668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109279 GCACGGATGGATAAAGAATAT pLKO.1 1029 CDS 100% 13.200 18.480 N Sf1 n/a
2 TRCN0000109276 GCGTAAAGATGGTCAGATGTT pLKO.1 677 CDS 100% 4.950 6.930 N Sf1 n/a
3 TRCN0000287698 GCGTAAAGATGGTCAGATGTT pLKO_005 677 CDS 100% 4.950 6.930 N Sf1 n/a
4 TRCN0000295110 CAACACGTGTGAGCGATAAAG pLKO_005 508 CDS 100% 13.200 9.240 N Sf1 n/a
5 TRCN0000218954 GATAAAGCACGGATGGATAAA pLKO_005 1023 CDS 100% 13.200 9.240 N SF1 n/a
6 TRCN0000001073 AGGATAAAGCACGGATGGATA pLKO.1 1021 CDS 100% 4.950 3.465 N SF1 n/a
7 TRCN0000109275 CCCAAGACGAATATCCAGAAA pLKO.1 538 CDS 100% 4.950 3.465 N Sf1 n/a
8 TRCN0000298367 CCCAAGACGAATATCCAGAAA pLKO_005 538 CDS 100% 4.950 3.465 N Sf1 n/a
9 TRCN0000109277 CCGATGGAACCAAGACACAAT pLKO.1 246 5UTR 100% 4.950 3.465 N Sf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318187.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01789 pDONR223 100% 80.9% 62.5% None (many diffs) n/a
2 ccsbBroad304_01789 pLX_304 0% 80.9% 62.5% V5 (many diffs) n/a
3 TRCN0000469808 GGGAACTTCGTCACAAGTTGTAGT pLX_317 26.7% 80.9% 62.5% V5 (many diffs) n/a
Download CSV